View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14773_low_12 (Length: 261)
Name: NF14773_low_12
Description: NF14773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14773_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 20 - 244
Target Start/End: Original strand, 32261164 - 32261388
Alignment:
| Q |
20 |
atcaggcaaaggttgtttttagcaaaacatggattggacatatattctatttacttgggacaaatttacagtgagaatcaaatcaaaattacaaatttga |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32261164 |
atcaagcaaaggttgtttttagcaaaacatggattggacatatattctatttacttggtacaaatttacagtgagaatcaaatcaaaattgcaaatttga |
32261263 |
T |
 |
| Q |
120 |
aagaagggaactagtcaaggtagctctttatttaggattccaaattctgttagttcttaaccaatagaaatgtctcatataatctatagacaatcaatgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32261264 |
aagaagggaactagtcaaggtagctctttatttaggattccaaattctgttagttcttaaccaatagaaatgtctcatataatctatagacaatcaatgt |
32261363 |
T |
 |
| Q |
220 |
tcaaaatgttaacaatgatcaaagt |
244 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
32261364 |
tcaaaatgttaacaatgatcaaagt |
32261388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University