View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14775_high_11 (Length: 229)
Name: NF14775_high_11
Description: NF14775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14775_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 3 - 213
Target Start/End: Original strand, 38881601 - 38881812
Alignment:
| Q |
3 |
gatggacatcatcaatcatcatgccatagacgcaagagcactaaagtgacaaagag-tttctggaaacagtgtctattgcgtgtatttttaatatcatgg |
101 |
Q |
| |
|
||||| ||||| || |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| ||| | ||||||| |
|
|
| T |
38881601 |
gatggtcatcaacattcatcatgccatagacgcaagagcactaaagttacaaagaggtttctggaaacagtgtctattgcgtgtatgtttgacatcatgg |
38881700 |
T |
 |
| Q |
102 |
tgatatattatgtgaatattacgatgatttgattttatagaagctataaaatgtagtttttgnnnnnnntcacggcgtagtcacccagattctatcatac |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38881701 |
tgatatattatgtgaatattacgatgatttgattttatagaagctataaaatgtagtttttaaaaaaaatcacggcgtagtcacccagattctatcatac |
38881800 |
T |
 |
| Q |
202 |
cagccatgatat |
213 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38881801 |
cagccatgatat |
38881812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University