View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14775_low_10 (Length: 230)

Name: NF14775_low_10
Description: NF14775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14775_low_10
NF14775_low_10
[»] chr1 (2 HSPs)
chr1 (135-212)||(50389179-50389254)
chr1 (11-61)||(50389328-50389378)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 135 - 212
Target Start/End: Complemental strand, 50389254 - 50389179
Alignment:
135 aactattacacatgaaagcactcaattgggttcgaccacgaatgatttagacaccataaccaatgtcttgaaattgtt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
50389254 aactattacacatgaaagcactcaattgggttcgaccacgaatgatttag--accataaccaatgtcttgaaattgtt 50389179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 11 - 61
Target Start/End: Complemental strand, 50389378 - 50389328
Alignment:
11 acatcatcaacctaagatacaaatcaccaaaacctcaattgagaataatcc 61  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||    
50389378 acatcaacaacctaagatacaaatcaccaaaacctcaattgagaataatcc 50389328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University