View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14775_low_5 (Length: 290)
Name: NF14775_low_5
Description: NF14775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14775_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 6 - 276
Target Start/End: Original strand, 38580131 - 38580402
Alignment:
| Q |
6 |
aaaaatgttctgcaatcaattataaattaca-gacattgaagtaaatagttgcataagcgtgagaaataaggaagccagagtataccgcgcttgctttcc |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38580131 |
aaaaatgttctgcaatcaattataaattacaagacattgaagtaaatagttgcataagcgtgagaaataaggaagccagagtataccgcgcttgctttcc |
38580230 |
T |
|
| Q |
105 |
tggggcgcttgtcctgggatgacctactgcagataattgtatcagctgcgtcgccttcatttgcaattccatttccatttgctgtgctgttctctttccc |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38580231 |
tggggcgtttgtcctgggatgacctactgcagataattgtatcagctgcgtcgccttcatttgcaattccatttccatttgctgtgctgttctctttccc |
38580330 |
T |
|
| Q |
205 |
gtgtgcaaaactctctcttgaagcaactggctgtaattgaaaaataaattacattatcagttacatgctagt |
276 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38580331 |
gtgcgcaaaactctctcttgaagcaactggctgtaattgaaaaataaattacattatcagttacatgctagt |
38580402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University