View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14775_low_6 (Length: 271)
Name: NF14775_low_6
Description: NF14775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14775_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 10 - 252
Target Start/End: Complemental strand, 8406415 - 8406173
Alignment:
| Q |
10 |
atataacaggatggtccactgatgaattataggtttcacgtattaagtgcttggcttcttgtccttgcttttcttctgttgctaatttttataatgtgaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8406415 |
atataacaggatggtccactgatgaattataggtttcacgtattaagtgcttggcttcttgtccttgcttttcttctgttgctaatttttataatgtgaa |
8406316 |
T |
 |
| Q |
110 |
aacgtttacttgattgacctgtccttatcacatgagatgatgatcgtttacttggttgactcaatgtttcccataatgctagttgacttggtccatatca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8406315 |
aacgtttacttgattgacctgtccttatcacatgagatgatgatcgtttacttggttgactcaatgtttcccataatgctagttgacttggtccatatca |
8406216 |
T |
 |
| Q |
210 |
tccaaacgtgtttttcatttcatcaaagctttaataacttagg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8406215 |
tccaaacgtgtttttcatttcatcaaagctttaataacttagg |
8406173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University