View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14775_low_9 (Length: 235)
Name: NF14775_low_9
Description: NF14775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14775_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 24 - 217
Target Start/End: Complemental strand, 28265818 - 28265625
Alignment:
| Q |
24 |
gttcgctgatctttcgcgttgtgaattggaaaaaagaagtatcagcaaatttcaagctggaacatgaatttagaagattataactcgtgaaaatgaagat |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265818 |
gttcgctgatctttcgcgttgtgaattggaaaaaagaagtatcagcaaatttcaagctggaacatgaatttagaagattataactcgtgaaaatgaagat |
28265719 |
T |
 |
| Q |
124 |
atcttcactaaagagatcaataattatccaatacaactaaattcatagcagctaacacaatctggaagaaaaatgtgagataaattgcgaattt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28265718 |
atcttcactaaagagatcaataattatccaatacaactaaattcatagcagctaacacaatctggaagaaaaatgtgagataaattgcgaattt |
28265625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University