View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14776_high_33 (Length: 272)
Name: NF14776_high_33
Description: NF14776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14776_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 103 - 256
Target Start/End: Original strand, 37676564 - 37676717
Alignment:
| Q |
103 |
cttccacttcccattcatatctctcccaaaccagacacagttttcgttttcccacaattaagttaccttctttcagcaacaataaccgtaataaccaccg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676564 |
cttccacttcccattcatatctctcccaaaccagacacagttttcgttttcccacaattaagttaccttctttcagcaacaataaccgtaataaccaccg |
37676663 |
T |
 |
| Q |
203 |
tgtcttctttaaagtctcagcttcatcttcatcttcgtttcaagctcttatatt |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676664 |
tgtcttctttaaagtctcagcttcatcttcatcttcgtttcaagctcttatatt |
37676717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 14 - 74
Target Start/End: Original strand, 37676475 - 37676535
Alignment:
| Q |
14 |
gatgaataaagtgatgatgaagatgactggttaatggttaatgaacatgaccatggcttct |
74 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37676475 |
gatgaataaagtgatgatgaagatgaatggttaatggttaatgaacatgaccatggcttct |
37676535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University