View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14776_low_16 (Length: 405)

Name: NF14776_low_16
Description: NF14776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14776_low_16
NF14776_low_16
[»] chr7 (17 HSPs)
chr7 (125-314)||(10221156-10221353)
chr7 (16-124)||(10221023-10221131)
chr7 (326-393)||(10221643-10221710)
chr7 (273-341)||(10221552-10221620)
chr7 (308-376)||(32278908-32278976)
chr7 (229-284)||(10221301-10221356)
chr7 (308-365)||(8075863-8075920)
chr7 (308-365)||(33996334-33996391)
chr7 (320-364)||(24612802-24612846)
chr7 (308-376)||(48243084-48243152)
chr7 (296-375)||(26239927-26240006)
chr7 (337-383)||(31634782-31634828)
chr7 (308-365)||(25620140-25620197)
chr7 (308-365)||(29469844-29469901)
chr7 (312-365)||(31892155-31892208)
chr7 (316-365)||(31892391-31892440)
chr7 (308-361)||(40746273-40746326)
[»] chr6 (11 HSPs)
chr6 (296-382)||(6542954-6543040)
chr6 (308-378)||(24554108-24554178)
chr6 (316-381)||(6054157-6054222)
chr6 (296-365)||(9705258-9705327)
chr6 (308-375)||(4868836-4868903)
chr6 (308-365)||(4868600-4868657)
chr6 (308-365)||(9705024-9705081)
chr6 (308-361)||(11721913-11721966)
chr6 (308-361)||(27772722-27772775)
chr6 (308-376)||(8566982-8567049)
chr6 (335-387)||(32993490-32993542)
[»] chr3 (10 HSPs)
chr3 (296-382)||(45138813-45138899)
chr3 (296-382)||(1800202-1800288)
chr3 (296-382)||(45138982-45139068)
chr3 (296-377)||(54368508-54368589)
chr3 (304-364)||(50930707-50930767)
chr3 (296-386)||(13741112-13741203)
chr3 (259-290)||(45138978-45139009)
chr3 (308-378)||(38791473-38791543)
chr3 (262-290)||(1800261-1800289)
chr3 (335-387)||(18895219-18895271)
[»] chr4 (11 HSPs)
chr4 (308-361)||(6218212-6218265)
chr4 (308-359)||(12869286-12869337)
chr4 (296-362)||(35609722-35609788)
chr4 (310-365)||(22231098-22231153)
chr4 (296-362)||(35609501-35609567)
chr4 (296-382)||(44118870-44118956)
chr4 (308-365)||(22863478-22863535)
chr4 (308-365)||(28245549-28245606)
chr4 (308-365)||(50543590-50543647)
chr4 (308-365)||(52559571-52559628)
chr4 (308-376)||(50543353-50543421)
[»] chr2 (17 HSPs)
chr2 (296-361)||(37769954-37770019)
chr2 (259-290)||(789399-789430)
chr2 (296-363)||(15124794-15124861)
chr2 (308-375)||(16419496-16419563)
chr2 (308-387)||(25082560-25082639)
chr2 (296-375)||(42639625-42639704)
chr2 (296-361)||(17854940-17855005)
chr2 (308-361)||(19191633-19191686)
chr2 (308-361)||(28407816-28407869)
chr2 (308-361)||(29718336-29718389)
chr2 (307-364)||(30006601-30006658)
chr2 (307-364)||(30063289-30063346)
chr2 (308-365)||(36352182-36352239)
chr2 (308-361)||(40718230-40718283)
chr2 (259-291)||(15124555-15124587)
chr2 (307-375)||(17525360-17525428)
chr2 (308-364)||(19570997-19571053)
[»] scaffold0129 (1 HSPs)
scaffold0129 (308-376)||(14296-14364)
[»] scaffold0481 (1 HSPs)
scaffold0481 (299-361)||(3485-3547)
[»] chr8 (10 HSPs)
chr8 (296-382)||(8716101-8716187)
chr8 (308-382)||(38447450-38447524)
chr8 (316-365)||(41790663-41790712)
chr8 (308-382)||(22638202-22638276)
chr8 (308-378)||(24532444-24532514)
chr8 (308-361)||(4828076-4828129)
chr8 (312-365)||(12688076-12688129)
chr8 (308-365)||(39052952-39053009)
chr8 (314-382)||(30201553-30201621)
chr8 (317-377)||(42049719-42049779)
[»] chr1 (16 HSPs)
chr1 (290-364)||(52907389-52907463)
chr1 (308-378)||(52961573-52961643)
chr1 (329-382)||(42819287-42819340)
chr1 (308-376)||(25713386-25713454)
chr1 (296-364)||(40316061-40316129)
chr1 (259-290)||(52907430-52907461)
chr1 (308-374)||(3169761-3169827)
chr1 (308-374)||(12244985-12245051)
chr1 (308-382)||(17452851-17452925)
chr1 (308-374)||(51588987-51589053)
chr1 (308-374)||(51589221-51589287)
chr1 (308-365)||(4113029-4113086)
chr1 (308-365)||(40079156-40079213)
chr1 (296-376)||(25145496-25145576)
chr1 (308-376)||(38733375-38733443)
chr1 (308-364)||(49316168-49316224)
[»] chr5 (13 HSPs)
chr5 (308-361)||(7607602-7607655)
chr5 (308-365)||(19705907-19705964)
chr5 (308-375)||(24528534-24528601)
chr5 (308-387)||(28510073-28510152)
chr5 (308-382)||(1564590-1564664)
chr5 (308-378)||(18333488-18333558)
chr5 (308-365)||(95289-95346)
chr5 (308-365)||(6413449-6413506)
chr5 (308-365)||(6413680-6413737)
chr5 (308-361)||(27133016-27133069)
chr5 (311-376)||(37782076-37782141)
chr5 (308-365)||(41666780-41666837)
chr5 (308-365)||(41667016-41667073)
[»] scaffold0766 (1 HSPs)
scaffold0766 (308-387)||(6256-6335)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 2e-59; HSPs: 17)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 125 - 314
Target Start/End: Original strand, 10221156 - 10221353
Alignment:
125 acttaaaatgaataacttgattgaatacctaatctttcaataaaaccaaattatgaacgtgacat--------aatatcaaataacacagcacaagataa 216  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || ||||        |||||||||||||||||||||||||||    
10221156 acttaaaatgtataacttgattgaatacctaatctttcaataaaaccaaattatgaaagtcacatcaagacggaatatcaaataacacagcacaagataa 10221255  T
217 atctaagaaattgtggttgggtcttactcaatcccacaaaacatcgtggttgggtcttacacaaccccacaaaatatcctggttggctcttacacaac 314  Q
    || |||||||| |||||| |||||| |||||| |||||||| ||||||||||||| |||||||| ||||||||| |||||||||| ||||||||||||    
10221256 atttaagaaatcgtggttaggtcttgctcaattccacaaaatatcgtggttgggttttacacaatcccacaaaacatcctggttgactcttacacaac 10221353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 16 - 124
Target Start/End: Original strand, 10221023 - 10221131
Alignment:
16 ataacttcagtaataaaattgtctatcatttatttataaattaagagaccacaatcaaatgaataaaactataagtgattaagtctataacatttgtgac 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10221023 ataacttcagtaataaaattgtctatcatttatttataaattaagagaccacaatcaaatgaataaaactataagtgattaagtctataacatttgtgac 10221122  T
116 ttaaataac 124  Q
    |||||||||    
10221123 ttaaataac 10221131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 326 - 393
Target Start/End: Original strand, 10221643 - 10221710
Alignment:
326 gtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttatttgatttagaa 393  Q
    ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
10221643 gtcttatatggtgaagattgtcctcacttataaacacattttcagaccatctcttatttgatttagaa 10221710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 273 - 341
Target Start/End: Original strand, 10221552 - 10221620
Alignment:
273 ttacacaaccccacaaaatatcctggttggctcttacacaactccacaaaaccgtcttatgtggtgaag 341  Q
    |||||||||| ||||||| ||| ||||||  ||||||||||||||||||||| |||||| |||| ||||    
10221552 ttacacaacctcacaaaacatcatggttgagtcttacacaactccacaaaacggtcttacgtggggaag 10221620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 308 - 376
Target Start/End: Original strand, 32278908 - 32278976
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatc 376  Q
    |||||||  |||||||||| |||||| ||||| |||||||| ||||||||||||||||  |||||||||    
32278908 acacaacctcacaaaaccggcttatgaggtgacgattgtccccacttataaacacattgtcagaccatc 32278976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 229 - 284
Target Start/End: Original strand, 10221301 - 10221356
Alignment:
229 gtggttgggtcttactcaatcccacaaaacatcgtggttgggtcttacacaacccc 284  Q
    |||||||||| |||| ||||||||||||||||| ||||||  ||||||||||||||    
10221301 gtggttgggttttacacaatcccacaaaacatcctggttgactcttacacaacccc 10221356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 365
Target Start/End: Complemental strand, 8075920 - 8075863
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||||||| ||||||| ||| || |||||||||| ||| ||||||||||||||||    
8075920 acacaactccataaaaccgacttgtgaggtgaagattatccccacttataaacacatt 8075863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 33996334 - 33996391
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||||||||||||||| ||| || ||||||||||| || |||||||||| |||||    
33996334 acacaactccacaaaaccgacttgtgaggtgaagattgcccccacttataaatacatt 33996391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 320 - 364
Target Start/End: Complemental strand, 24612846 - 24612802
Alignment:
320 aaaaccgtcttatgtggtgaagattgtcctcacttataaacacat 364  Q
    ||||||||||| || ||||||||| ||||||||||||||||||||    
24612846 aaaaccgtcttgtgaggtgaagatagtcctcacttataaacacat 24612802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 376
Target Start/End: Original strand, 48243084 - 48243152
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatc 376  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||  |||||||||    
48243084 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccatc 48243152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 375
Target Start/End: Original strand, 26239927 - 26240006
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccat 375  Q
    ||||||| ||| ||||||| |||||| |||| ||| || ||||| ||||| || ||||||||||||||||  ||||||||    
26239927 tggttgggtctaacacaaccccacaataccgacttgtgaggtgaggattgcccccacttataaacacattgtcagaccat 26240006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 337 - 383
Target Start/End: Complemental strand, 31634828 - 31634782
Alignment:
337 tgaagattgtcctcacttataaacacatttccagaccatctcttatt 383  Q
    |||||||||||||||||||||||||||||| ||  |||| |||||||    
31634828 tgaagattgtcctcacttataaacacattttcatgccatatcttatt 31634782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Complemental strand, 25620197 - 25620140
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
25620197 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatt 25620140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Complemental strand, 29469901 - 29469844
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||||||||||||||| ||| |  ||||| ||||| || ||||||||||||||||    
29469901 acacaactccacaaaaccggcttgtaaggtgaggattgcccccacttataaacacatt 29469844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 312 - 365
Target Start/End: Complemental strand, 31892208 - 31892155
Alignment:
312 aactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||||||||||| ||| || ||||| |||||||| |||||||||| |||||    
31892208 aactccacaaaaccggcttgtgaggtgaggattgtccccacttataaatacatt 31892155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 316 - 365
Target Start/End: Complemental strand, 31892440 - 31892391
Alignment:
316 ccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||||||| ||| || |||||||||||||| |||||||||| |||||    
31892440 ccacaaaaccggcttgtgaggtgaagattgtccccacttataaatacatt 31892391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Complemental strand, 40746326 - 40746273
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||| |||||||| || |||||| ||||| ||||| |||||||||||||||    
40746326 acacaaccccacaaaatcggcttatgaggtgaggattgccctcacttataaaca 40746273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 11)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 296 - 382
Target Start/End: Original strand, 6542954 - 6543040
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||| ||| ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||  |||||||||||||||    
6542954 tggttgggtctaacacaaccccacaaaaccggcttctgaggtgatgattgcccccacttataaacacattgtcagaccatctcttat 6543040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 308 - 378
Target Start/End: Complemental strand, 24554178 - 24554108
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctc 378  Q
    ||||||||||||||||||| ||| || ||||||||||| || |||||||||| | |||  |||||||||||    
24554178 acacaactccacaaaaccggcttgtgaggtgaagattgcccccacttataaatatattgtcagaccatctc 24554108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 316 - 381
Target Start/End: Complemental strand, 6054222 - 6054157
Alignment:
316 ccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctctta 381  Q
    ||||||||| | |||||| ||||| ||||||||||||||||||||| |||  |||||||| |||||    
6054222 ccacaaaactgacttatgaggtgatgattgtcctcacttataaacagattgtcagaccatatctta 6054157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 365
Target Start/End: Complemental strand, 9705327 - 9705258
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||| ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
9705327 tggttgggtctaacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatt 9705258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 375
Target Start/End: Original strand, 4868836 - 4868903
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccat 375  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || |||||||||||||||| |||| ||||    
4868836 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccaggccat 4868903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 4868600 - 4868657
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
4868600 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatt 4868657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Complemental strand, 9705081 - 9705024
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
9705081 acacaaccccacaaaaccgacttgtgaggtgatgattgcccccacttataaacacatt 9705024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Complemental strand, 11721966 - 11721913
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||| ||||||||||| |||||| ||||| ||||| || ||||||||||||    
11721966 acacaaccccacaaaaccggcttatgaggtgaggattgcccccacttataaaca 11721913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Complemental strand, 27772775 - 27772722
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||||||||||||||| ||| || ||||| ||||| || ||||||||||||    
27772775 acacaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 27772722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 376
Target Start/End: Original strand, 8566982 - 8567049
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatc 376  Q
    ||||||| |||||||||||  || || ||||| |||||||| ||||||||||||||||  |||||||||    
8566982 acacaaccccacaaaaccggtttgtgaggtgaggattgtcc-cacttataaacacattgtcagaccatc 8567049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 335 - 387
Target Start/End: Complemental strand, 32993542 - 32993490
Alignment:
335 ggtgaagattgtcctcacttataaacacatttccagaccatctcttatttgat 387  Q
    |||||||||||||| ||||||||||||||| |  |||| |||| |||||||||    
32993542 ggtgaagattgtccccacttataaacacatatttagactatcttttatttgat 32993490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 10)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 296 - 382
Target Start/End: Original strand, 45138813 - 45138899
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||| ||| | ||||| ||||||||||| ||| || ||||| ||||| || |||||||||||||||| ||||||||||||||||    
45138813 tggttgggtctcatacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgccagaccatctcttat 45138899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 382
Target Start/End: Complemental strand, 1800288 - 1800202
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||| ||||||||||| |||||||||||  || || ||||| ||||| || |||||||||| ||| |  |||||||||||||||    
1800288 tggttgggtcttacacaaccccacaaaaccggtttgtgaggtgaggattgcccccacttataaatacactgtcagaccatctcttat 1800202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 382
Target Start/End: Original strand, 45138982 - 45139068
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||| ||||||||||| ||||||||||| ||| || ||||| ||||| || ||||||| ||||| ||  ||| |||||||||||    
45138982 tggttgggtcttacacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttattaacacgttgtcaggccatctcttat 45139068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 296 - 377
Target Start/End: Complemental strand, 54368589 - 54368508
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatct 377  Q
    ||||||| ||| ||||||| ||| ||||||| ||| || ||||| ||||| || ||||||||||||||||| ||| ||||||    
54368589 tggttgggtctaacacaaccccataaaaccggcttgtgaggtgaggattgcccccacttataaacacattttcaggccatct 54368508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 304 - 364
Target Start/End: Complemental strand, 50930767 - 50930707
Alignment:
304 tcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacat 364  Q
    ||||||||||| |||||||||||| || || ||||| ||||| || |||||||||||||||    
50930767 tcttacacaaccccacaaaaccgttttgtgaggtgaggattgcccccacttataaacacat 50930707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 386
Target Start/End: Original strand, 13741112 - 13741203
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagatt-gtcctcacttataaacacatttccagaccatctcttatttga 386  Q
    ||||||| ||| ||||||| ||| ||||||| ||| || ||||| |||| |||| ||||||||||||||||  || |||||||| |||||||    
13741112 tggttgggtctaacacaaccccaaaaaaccggcttgtgaggtgaggatttgtccccacttataaacacattgtcaaaccatctcctatttga 13741203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 259 - 290
Target Start/End: Original strand, 45138978 - 45139009
Alignment:
259 atcgtggttgggtcttacacaaccccacaaaa 290  Q
    ||||||||||||||||||||||||||||||||    
45138978 atcgtggttgggtcttacacaaccccacaaaa 45139009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 378
Target Start/End: Original strand, 38791473 - 38791543
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctc 378  Q
    ||||||| |||||||| ||  || || ||||| ||||||||||||||||||| |||||  |||||||||||    
38791473 acacaaccccacaaaatcgatttgtgaggtgaggattgtcctcacttataaatacattgtcagaccatctc 38791543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 290
Target Start/End: Complemental strand, 1800289 - 1800261
Alignment:
262 gtggttgggtcttacacaaccccacaaaa 290  Q
    |||||||||||||||||||||||||||||    
1800289 gtggttgggtcttacacaaccccacaaaa 1800261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 335 - 387
Target Start/End: Complemental strand, 18895271 - 18895219
Alignment:
335 ggtgaagattgtcctcacttataaacacatttccagaccatctcttatttgat 387  Q
    ||||| ||||||||||  ||||||| |||||  ||||||||||||||||||||    
18895271 ggtgatgattgtcctcgattataaatacattatcagaccatctcttatttgat 18895219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000002; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 308 - 361
Target Start/End: Complemental strand, 6218265 - 6218212
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||||||||||||||||||| || ||||||||||| || ||||||||||||    
6218265 acacaactccacaaaaccgtcttgtgaggtgaagattgcccccacttataaaca 6218212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 308 - 359
Target Start/End: Original strand, 12869286 - 12869337
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaa 359  Q
    ||||||| |||||||||||||||||| ||||| |||||||| ||||||||||    
12869286 acacaaccccacaaaaccgtcttatgaggtgaggattgtccccacttataaa 12869337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 362
Target Start/End: Original strand, 35609722 - 35609788
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacac 362  Q
    ||||||| ||||||||||| ||||||||||| ||| || ||||| ||||| || |||||||||||||    
35609722 tggttgggtcttacacaaccccacaaaaccggcttgtgaggtgaggattggccccacttataaacac 35609788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 310 - 365
Target Start/End: Original strand, 22231098 - 22231153
Alignment:
310 acaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||| ||||||||||| ||| || ||||| |||||||| ||||||||||||||||    
22231098 acaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaacacatt 22231153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 362
Target Start/End: Original strand, 35609501 - 35609567
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacac 362  Q
    ||||||| | ||||||||| ||||||||||| ||| || ||||| ||||| || |||||||||||||    
35609501 tggttgggtgttacacaaccccacaaaaccgacttgtgaggtgaggattgcccccacttataaacac 35609567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 296 - 382
Target Start/End: Original strand, 44118870 - 44118956
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    |||| |||||| ||||||| ||||||||| | ||| || ||||| ||||  || ||||||||||||||||  ||| |||||||||||    
44118870 tggtgggctctaacacaaccccacaaaacgggcttgtgaggtgaggattacccccacttataaacacattgtcaggccatctcttat 44118956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Complemental strand, 22863535 - 22863478
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
22863535 acacaaccccacaaaaccggcttgtggggtgaggattgcccccacttataaacacatt 22863478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 28245549 - 28245606
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
28245549 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatt 28245606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 50543590 - 50543647
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||||||||||||||| ||| || ||||| ||||| || |||||||| |||||||    
50543590 acacaactccacaaaaccggcttgtgaggtgaggattgcccccacttatacacacatt 50543647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Complemental strand, 52559628 - 52559571
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
52559628 acacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacatt 52559571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 376
Target Start/End: Original strand, 50543353 - 50543421
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatc 376  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || |||||||| |||||||  |||||||||    
50543353 acacaaccccacaaaaccggcttgtggggtgaggattgcccccacttatacacacattgtcagaccatc 50543421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 17)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 296 - 361
Target Start/End: Original strand, 37769954 - 37770019
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||| ||| ||||||| ||||||||||| |||||| ||||||||||| || ||||||||||||    
37769954 tggttgggtctaacacaaccccacaaaaccggcttatgaggtgaagattgcccccacttataaaca 37770019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 259 - 290
Target Start/End: Original strand, 789399 - 789430
Alignment:
259 atcgtggttgggtcttacacaaccccacaaaa 290  Q
    ||||||||||||||||||||||||||||||||    
789399 atcgtggttgggtcttacacaaccccacaaaa 789430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 363
Target Start/End: Original strand, 15124794 - 15124861
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacaca 363  Q
    ||||||| ||| ||||||| |||||||||||  || ||  |||||||||| |||||||||||||||||    
15124794 tggttgggtctaacacaaccccacaaaaccgaattgtgaagtgaagattgccctcacttataaacaca 15124861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 375
Target Start/End: Complemental strand, 16419563 - 16419496
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccat 375  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||  ||||||||    
16419563 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccat 16419496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 387
Target Start/End: Original strand, 25082560 - 25082639
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttatttgat 387  Q
    ||||||| ||||||||| | ||| || ||||| ||||| ||  |||||||||||||||  ||||||||||||||| ||||    
25082560 acacaaccccacaaaactggcttgtgaggtgatgattgcccctacttataaacacattgtcagaccatctcttatctgat 25082639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 296 - 375
Target Start/End: Original strand, 42639625 - 42639704
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccat 375  Q
    ||||||| ||| ||||||| ||||||||||  ||| || ||||| |||||||| || |||||||||||||  ||||||||    
42639625 tggttgggtctaacacaaccccacaaaaccagcttgtgaggtgacgattgtccccatttataaacacattgtcagaccat 42639704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 296 - 361
Target Start/End: Original strand, 17854940 - 17855005
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||| |||  |||||| ||||||||||| ||| || ||||| ||||| |||||||||||||||    
17854940 tggttgggtctagcacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 17855005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Original strand, 19191633 - 19191686
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||| ||||||||||| ||| || ||||| |||||||| ||||||||||||    
19191633 acacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaaca 19191686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Original strand, 28407816 - 28407869
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||||||||||||||| ||| || ||||| ||||| || ||||||||||||    
28407816 acacaactccacaaaaccggcttgtgaggtgaggattgcccccacttataaaca 28407869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Complemental strand, 29718389 - 29718336
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||| ||||||||||| ||| || ||||| ||||| |||||||||||||||    
29718389 acacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 29718336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 30006601 - 30006658
Alignment:
307 tacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacat 364  Q
    ||||||||  |||||||||| ||| |||||||| |||| ||| |||||||||||||||    
30006601 tacacaacctcacaaaaccggcttgtgtggtgatgattatccccacttataaacacat 30006658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 307 - 364
Target Start/End: Original strand, 30063289 - 30063346
Alignment:
307 tacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacat 364  Q
    ||||||||  |||||||||| ||| |||||||| |||| ||| |||||||||||||||    
30063289 tacacaacctcacaaaaccggcttgtgtggtgatgattatccccacttataaacacat 30063346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 36352182 - 36352239
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
36352182 acacaaccccacaaaaccggcttttgaggtgatgattgcccccacttataaacacatt 36352239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Original strand, 40718230 - 40718283
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    |||||||||||||||||||  || || ||||| ||||| |||||||||||||||    
40718230 acacaactccacaaaaccggtttgtgaggtgatgattgccctcacttataaaca 40718283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 259 - 291
Target Start/End: Original strand, 15124555 - 15124587
Alignment:
259 atcgtggttgggtcttacacaaccccacaaaat 291  Q
    ||||||||||||||| |||||||||||||||||    
15124555 atcgtggttgggtctaacacaaccccacaaaat 15124587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 307 - 375
Target Start/End: Original strand, 17525360 - 17525428
Alignment:
307 tacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccat 375  Q
    |||||||  ||||||||||| ||| || ||||| ||||| || ||||||||||||||||  ||||||||    
17525360 tacacaatcccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccat 17525428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 364
Target Start/End: Original strand, 19570997 - 19571053
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacat 364  Q
    |||||| ||||||||| || |||||| ||||| ||||| || |||||||||||||||    
19570997 acacaattccacaaaatcgacttatgaggtgaggattgcccccacttataaacacat 19571053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0129
Description:

Target: scaffold0129; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 308 - 376
Target Start/End: Complemental strand, 14364 - 14296
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatc 376  Q
    ||||||| ||||||||||| ||| || ||||| |||||||| ||||||||||||||||  |||||||||    
14364 acacaaccccacaaaaccggcttgtgaggtgatgattgtccccacttataaacacattgtcagaccatc 14296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0481 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0481
Description:

Target: scaffold0481; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 299 - 361
Target Start/End: Original strand, 3485 - 3547
Alignment:
299 ttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    |||| ||| ||||||| ||||||||||| ||| || |||||||||||||| ||||||||||||    
3485 ttgggtctaacacaaccccacaaaaccggcttgtgaggtgaagattgtccccacttataaaca 3547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000001; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 296 - 382
Target Start/End: Complemental strand, 8716187 - 8716101
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||| ||| ||||||| |||||||| || |||||| ||||| ||||| | |||||| ||||||||||   ||||||||||||||    
8716187 tggttgggtctaacacaaccccacaaaatcggcttatgaggtgaggattgccttcacttttaaacacattgtgagaccatctcttat 8716101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 308 - 382
Target Start/End: Original strand, 38447450 - 38447524
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||  ||| |||||||||||    
38447450 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcaggccatctcttat 38447524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 316 - 365
Target Start/End: Complemental strand, 41790712 - 41790663
Alignment:
316 ccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||||||| |||||| ||||| |||||||| ||||||||||||||||    
41790712 ccacaaaaccggcttatgaggtgaggattgtccccacttataaacacatt 41790663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 382
Target Start/End: Original strand, 22638202 - 22638276
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||| ||||||||||| ||| |||||||| ||||| ||  |||||||||||| ||  ||| |||||||||||    
22638202 acacaaccccacaaaaccggcttgtgtggtgaggattgcccctacttataaacactttgacaggccatctcttat 22638276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 378
Target Start/End: Original strand, 24532444 - 24532514
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctc 378  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||  ||| |||||||    
24532444 acacaaccccacaaaaccggcttgtgaggtgatgattgcccccacttataaacacattgtcaggccatctc 24532514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Complemental strand, 4828129 - 4828076
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||| ||||||||||| ||| || ||||| |||||||| ||||||||||||    
4828129 acacaaccccacaaaaccggcttgtgaggtgaggattgtccccacttataaaca 4828076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 312 - 365
Target Start/End: Complemental strand, 12688129 - 12688076
Alignment:
312 aactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||||||||||| ||| || ||||  ||||| |||||||||||||||||||    
12688129 aactccacaaaaccggcttgtgaggtggggattgccctcacttataaacacatt 12688076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 39052952 - 39053009
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
39052952 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatt 39053009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 314 - 382
Target Start/End: Original strand, 30201553 - 30201621
Alignment:
314 ctccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||||||||| ||| || ||||||||||| || |||||||||||  ||| |||  |||||||||||    
30201553 ctccacaaaaccggcttgtgaggtgaagattgaccccacttataaacttattgccatgccatctcttat 30201621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 317 - 377
Target Start/End: Original strand, 42049719 - 42049779
Alignment:
317 cacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatct 377  Q
    |||||||||| ||| || ||||| ||||| || ||||||||||||||| ||||| ||||||    
42049719 cacaaaaccggcttgtggggtgaggattgcccccacttataaacacatgtccaggccatct 42049779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 16)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 290 - 364
Target Start/End: Complemental strand, 52907463 - 52907389
Alignment:
290 atatcctggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacat 364  Q
    ||||| ||||||| ||||||||||| ||||||||||  ||| || ||||| ||||| || |||||||||||||||    
52907463 atatcgtggttgggtcttacacaaccccacaaaaccagcttgtgaggtgaggattgcccccacttataaacacat 52907389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 308 - 378
Target Start/End: Complemental strand, 52961643 - 52961573
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctc 378  Q
    ||||||| ||| ||||||| ||| || ||||| ||||| |||||||||||||||||||  |||||||||||    
52961643 acacaaccccataaaaccggcttttgaggtgaggattgccctcacttataaacacattgtcagaccatctc 52961573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 329 - 382
Target Start/End: Complemental strand, 42819340 - 42819287
Alignment:
329 ttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||| ||||| ||||||| |||||||||||||||||  |||||||||||||||    
42819340 ttatgaggtgatgattgtcgtcacttataaacacattgtcagaccatctcttat 42819287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 308 - 376
Target Start/End: Complemental strand, 25713454 - 25713386
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatc 376  Q
    ||||||||||||||||| | ||| || ||||| ||||| || ||||||||||||||||  |||||||||    
25713454 acacaactccacaaaactggcttgtgaggtgacgattgcccccacttataaacacattgtcagaccatc 25713386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 296 - 364
Target Start/End: Original strand, 40316061 - 40316129
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacat 364  Q
    ||||||| ||| |||||||  |||||||||| |||||| ||||| ||||| || |||||||||||||||    
40316061 tggttggatctaacacaacctcacaaaaccggcttatgaggtgaggattgaccccacttataaacacat 40316129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 259 - 290
Target Start/End: Complemental strand, 52907461 - 52907430
Alignment:
259 atcgtggttgggtcttacacaaccccacaaaa 290  Q
    ||||||||||||||||||||||||||||||||    
52907461 atcgtggttgggtcttacacaaccccacaaaa 52907430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 374
Target Start/End: Complemental strand, 3169827 - 3169761
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagacca 374  Q
    ||||||| ||||||||||| ||| || ||||||||||| || |||||||||||| |||  |||||||    
3169827 acacaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaacaaattgtcagacca 3169761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 374
Target Start/End: Original strand, 12244985 - 12245051
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagacca 374  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || |||||||||||| ||| ||||||||    
12244985 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacaaattgccagacca 12245051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 382
Target Start/End: Original strand, 17452851 - 17452925
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||| ||||||||||| ||| || ||||||||||| || |||||||||| |||||  ||| |||| ||||||    
17452851 acacaaccccacaaaaccggcttgtgaggtgaagattgcccccacttataaatacattgtcaggccatgtcttat 17452925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 374
Target Start/End: Complemental strand, 51589053 - 51588987
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagacca 374  Q
    ||||||| ||||||||||| ||| || ||||| ||||| ||||||||||||||| |||  |||||||    
51589053 acacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagacca 51588987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 374
Target Start/End: Complemental strand, 51589287 - 51589221
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagacca 374  Q
    ||||||| ||||||||||| ||| || ||||| ||||| ||||||||||||||| |||  |||||||    
51589287 acacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaacaaattgtcagacca 51589221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 4113029 - 4113086
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
4113029 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatt 4113086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Complemental strand, 40079213 - 40079156
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
40079213 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatt 40079156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 296 - 376
Target Start/End: Original strand, 25145496 - 25145576
Alignment:
296 tggttggctcttacacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatc 376  Q
    ||||||| ||| |||||||  |||||||||| ||| || ||||| ||||| || |||| |||||||||||  |||||||||    
25145496 tggttgggtctaacacaacctcacaaaaccgacttgtgaggtgaggattgcccccactaataaacacattgtcagaccatc 25145576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 376
Target Start/End: Complemental strand, 38733443 - 38733375
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatc 376  Q
    |||||||  |||||||||| | |||| ||||| ||||| ||||||||||||||| |||  |||||||||    
38733443 acacaacctcacaaaaccggcctatgaggtgaggattgccctcacttataaacatattgtcagaccatc 38733375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 308 - 364
Target Start/End: Original strand, 49316168 - 49316224
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacat 364  Q
    ||||||||||||||||| |  || || | |||||||||||| |||||||||||||||    
49316168 acacaactccacaaaactgatttgtgagatgaagattgtccccacttataaacacat 49316224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 34; Significance: 0.0000000006; HSPs: 13)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 361
Target Start/End: Complemental strand, 7607655 - 7607602
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||||||||||||||| ||| || |||||||||||||  ||||||||||||    
7607655 acacaactccacaaaaccggcttgtgaggtgaagattgtctccacttataaaca 7607602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 308 - 365
Target Start/End: Complemental strand, 19705964 - 19705907
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||||||||||||||| |||||  ||||| ||||| || ||||||||||||||||    
19705964 acacaactccacaaaaccggcttataaggtgaggattgcccccacttataaacacatt 19705907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 375
Target Start/End: Complemental strand, 24528601 - 24528534
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccat 375  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||  ||||||||    
24528601 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacattgtcagaccat 24528534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 387
Target Start/End: Complemental strand, 28510152 - 28510073
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttatttgat 387  Q
    ||||||| ||||||||||| |||||| | ||| ||||| | |||||||||||||||||  |||  |||||||||| ||||    
28510152 acacaaccccacaaaaccggcttatgagatgaggattgccttcacttataaacacattgtcaggtcatctcttatctgat 28510073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 382
Target Start/End: Original strand, 1564590 - 1564664
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttat 382  Q
    ||||||| ||||||||| ||||| ||  |||| ||||| || ||||||||| ||||||  |||||||||||||||    
1564590 acacaaccccacaaaactgtcttgtgatgtgaggattgcccccacttataatcacattgtcagaccatctcttat 1564664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 378
Target Start/End: Original strand, 18333488 - 18333558
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctc 378  Q
    ||||||| ||||||||||| ||| || ||||| ||||  || ||||||||||||||||  |||||||||||    
18333488 acacaaccccacaaaaccggcttgtgaggtgaggattacccccacttataaacacattgtcagaccatctc 18333558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 95289 - 95346
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || | ||| |||||||| ||||||||||||||||    
95289 acacaaccccacaaaaccggcttgtgagatgaggattgtccccacttataaacacatt 95346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 6413449 - 6413506
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| |||||||| || |||||| ||||| ||||| || ||||||||||||||||    
6413449 acacaaccccacaaaatcggcttatgaggtgaggattgcccccacttataaacacatt 6413506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 6413680 - 6413737
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||| ||||||| |||||| ||||| ||||||||  |||||||||||||||    
6413680 acacaaccccaaaaaaccggcttatgaggtgaggattgtccctacttataaacacatt 6413737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 361
Target Start/End: Original strand, 27133016 - 27133069
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaaca 361  Q
    ||||||| ||||||||||| ||| || ||||| ||||| |||||||||||||||    
27133016 acacaaccccacaaaaccggcttgtgaggtgaggattgccctcacttataaaca 27133069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 376
Target Start/End: Original strand, 37782076 - 37782141
Alignment:
311 caactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatc 376  Q
    |||||||||||||||  ||| || ||||| ||||| || ||||||||||||||||  |||||||||    
37782076 caactccacaaaaccagcttgtgaggtgatgattgcccccacttataaacacattgtcagaccatc 37782141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 41666780 - 41666837
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
41666780 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatt 41666837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 41667016 - 41667073
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatt 365  Q
    ||||||| ||||||||||| ||| || ||||| ||||| || ||||||||||||||||    
41667016 acacaaccccacaaaaccggcttgtgaggtgaggattgcccccacttataaacacatt 41667073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0766 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: scaffold0766
Description:

Target: scaffold0766; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 308 - 387
Target Start/End: Complemental strand, 6335 - 6256
Alignment:
308 acacaactccacaaaaccgtcttatgtggtgaagattgtcctcacttataaacacatttccagaccatctcttatttgat 387  Q
    ||||||| |||||||| || ||| || ||||| ||||| || ||||||||||||||||  ||||| ||||||||| ||||    
6335 acacaaccccacaaaatcggcttgtgaggtgaggattgcccccacttataaacacattgtcagactatctcttatctgat 6256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University