View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14776_low_21 (Length: 346)
Name: NF14776_low_21
Description: NF14776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14776_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 17 - 341
Target Start/End: Original strand, 8578030 - 8578353
Alignment:
| Q |
17 |
cttttaacctgtcaaaaatatttttcccgatccagtatatttcttttggtggtgctctctacaatttttgctataagtttatccaactatatgtttagta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8578030 |
cttttaacctgtcaaaaatatttttcccgatccagtatatttcttttggtggtgttctctacaatttttgctataagtttatccaactatatatttagta |
8578129 |
T |
 |
| Q |
117 |
aatttattgtcaatattgcaaattttaactacaaatcccaacttaacgaaaaagctttttgcaaattgcaatatattttgagacgagttttctacgattt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8578130 |
aatttattgtcaatattgcaaattttaactacaaatcccaacttaacgaaaaagctttttgcaaattgcaatatattttgagacgagttttctacgattt |
8578229 |
T |
 |
| Q |
217 |
ttgctacagatttatctatccattacattagtaaactattgacgatatcgctttgttttcctacaaattccaaagttacagaaaaatttgcaggaaatca |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8578230 |
ttgctacagatttatctatccattacattagtaaactattgacgatatcgctttgttttcctacaaattcc-aagttacagaaaaatttgcaggaaatca |
8578328 |
T |
 |
| Q |
317 |
acaactctatctctctcatctctgc |
341 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
8578329 |
acaactctatctctctcatctctgc |
8578353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University