View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14776_low_40 (Length: 244)
Name: NF14776_low_40
Description: NF14776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14776_low_40 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 22 - 244
Target Start/End: Original strand, 34274389 - 34274616
Alignment:
| Q |
22 |
aggttttccttttatctataaaagtttaacttcatatttcacttctcattaccctcccgccgcgcagctgttatcatcaaccctcgcctctctattccat |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34274389 |
aggttttccttttatctataaaagtttaacttcatatttcacttctcattaccctcccgccgcgcagctattatcatcaaccctcgcctctctattccat |
34274488 |
T |
|
| Q |
122 |
ttctctctacaggtaa--tgtctctctccctttcttctact---accaccattacatgcacgttaaatttcacatcttcaatgtaatcatcttagctatg |
216 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34274489 |
ttctctctacaggtaacgtctctctctccctttcttctactaccaccaccattacatgcacgttgaatttcacatcttcaatgtaatcatcttagctatg |
34274588 |
T |
|
| Q |
217 |
aaaaatgaacttgatatttgaattttga |
244 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
34274589 |
acaaatgaacttgatatttgaattttga |
34274616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University