View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14776_low_43 (Length: 236)
Name: NF14776_low_43
Description: NF14776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14776_low_43 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 29543668 - 29543464
Alignment:
| Q |
18 |
gtaagcaaatccagaattaaccaatgcaagtaaacgaagatgtctcgtttcacctgtgtaaattaaaattatcttttccgattaatctttaactcatgtt |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
29543668 |
gtaagcaaatcaagaattaaccaatgcaagtaaactaagatgtctcgtttcacctgtgtaaattaaaatgatcttttccgagtaatctttaactcatgtt |
29543569 |
T |
|
| Q |
118 |
tcatattgatgtatgccattggctctgttacaattagcaacgaatatatatatcaatctttctcctttttagttactctcacaagataattagtcagaga |
217 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29543568 |
tcatattgatgtatgtcattggctctgttataattagcaac--aaatatatatcaatctttctccttttcagttactctcacaagataattagtcagaga |
29543471 |
T |
|
| Q |
218 |
ataattt |
224 |
Q |
| |
|
||||||| |
|
|
| T |
29543470 |
ataattt |
29543464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University