View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14776_low_47 (Length: 213)

Name: NF14776_low_47
Description: NF14776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14776_low_47
NF14776_low_47
[»] chr8 (2 HSPs)
chr8 (79-197)||(37012744-37012860)
chr8 (1-31)||(37012717-37012747)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 79 - 197
Target Start/End: Original strand, 37012744 - 37012860
Alignment:
79 catcgtttcataatactgtcgtctctcatactgatgcaaagtgtggtgatgcaataggaaatcgaatggtgatgttgtaggtgtgagacaatatccaaga 178  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||  ||||||||||| |||| |    
37012744 catcgtttcataatactgtcgtctctcatactgattcaaagtgtggtgatacaataggaaatcgaatggtgatgttgtag--gtgagacaataaccaata 37012841  T
179 taaagaatttgagaaaaat 197  Q
    |||||||||||||||||||    
37012842 taaagaatttgagaaaaat 37012860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 37012717 - 37012747
Alignment:
1 attattctggtggtgaagccaagaattcatc 31  Q
    |||||||||||||||||||||||||||||||    
37012717 attattctggtggtgaagccaagaattcatc 37012747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University