View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14776_low_48 (Length: 205)
Name: NF14776_low_48
Description: NF14776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14776_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 9e-32; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 15 - 127
Target Start/End: Original strand, 47199228 - 47199351
Alignment:
| Q |
15 |
agaagaacaaatgataacatgtcatacataatttgagattgtgcttaacttaa-----------gttttccaaaaatctacgacttctatatattgattt |
103 |
Q |
| |
|
|||||| |||||| || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47199228 |
agaagatcaaatgctatcatgtcatacataatttgagattgtgcttaacttaaaaatctttcaagttttccaaaaatctacgacttctatatattgattt |
47199327 |
T |
|
| Q |
104 |
gtttctctggatatcaagtatacc |
127 |
Q |
| |
|
||||||||||||||||| |||||| |
|
|
| T |
47199328 |
gtttctctggatatcaattatacc |
47199351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 125 - 190
Target Start/End: Original strand, 47199401 - 47199466
Alignment:
| Q |
125 |
accatgccatggatagaaaattttgattatgatcgttcattaactcgcatatgatcatatatgcaa |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47199401 |
accatgccatggatagaaaattttgattatgattattcattaactcgcatatgatcatatatgcaa |
47199466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University