View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14777_high_22 (Length: 228)
Name: NF14777_high_22
Description: NF14777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14777_high_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 3 - 216
Target Start/End: Original strand, 46126201 - 46126414
Alignment:
| Q |
3 |
aagactgctgaaactgctcatcatgtctttcttgattgtgctattacttgtcagctttaagactggttcatgaagggcacaaagcagcagcttgacctca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46126201 |
aagactgctgaaactgctcatcatgtctttcttgattgtgctattacttgtcagctttaagactggctcatgaagggcacaaagcagcagcttgacctca |
46126300 |
T |
|
| Q |
103 |
ctagctatctttccttgcttcttggccgtctgggaatagggagcaaacttgtgcagcaggttatgaacactgatattattcatactatatggagtatatg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46126301 |
ctagctatctttccttgcttcttggccgtctgggaatagggagcaaacttgtgcagcaggttatgaacactgatattattcatactatatggagtatatg |
46126400 |
T |
|
| Q |
203 |
gttggagagaaatg |
216 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
46126401 |
gttggagagaaatg |
46126414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University