View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14777_low_12 (Length: 311)
Name: NF14777_low_12
Description: NF14777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14777_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 69 - 295
Target Start/End: Complemental strand, 5442488 - 5442250
Alignment:
| Q |
69 |
gaacacagacaattgttaaaataacaaatgtttatgttatgaatatgatgcaacacttcctctttatttataatttttcaaagacttctgca----tact |
164 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
5442488 |
gaactcagacaattgttaaaataacaaatgtttatcttatgaatatgatgcaacacttcctctttatttataatttttcaaagacttcggcatacttact |
5442389 |
T |
 |
| Q |
165 |
tgctgtgagcgatgtggggctcatatt---gggttattgtaattttatcataccattaatctttcacttct-----ctttcctttaccacagcaacatgg |
256 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5442388 |
tgctgtgagcgatgtggggcttatattcacgggttattgtaattttatcataccattaatctttcacttctctttcctttcctttaccacagcaacatgg |
5442289 |
T |
 |
| Q |
257 |
taagcagccacctctcctccattttttagaaatataagc |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5442288 |
taagcagccacctctcctccattttttagaaatataagc |
5442250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University