View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14777_low_15 (Length: 291)
Name: NF14777_low_15
Description: NF14777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14777_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 27122662 - 27122423
Alignment:
| Q |
1 |
attcattatgattctgatgatcatcacgtccacgacacctatttataggggagcaacctcgagtgtaatttccttctgtatcattataatgatgatgatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27122662 |
attcattatgattctgatgatcatcacgtccacgacacctatttataggggagcaacctcgagtgtaatttccttctgtatcattataatgatgatgatt |
27122563 |
T |
 |
| Q |
101 |
ttttcttgatctcttctctatatctttatatgaaatttctccctcgaccagattgttctggtttaacataaccatactaattaggagaaaagaaatgaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27122562 |
ttttcttgatctcttctctatatctttaaatgaaatttctccctcgaccagattgttctggtttaacataaccatactaattaggagaaaagaaatgaac |
27122463 |
T |
 |
| Q |
201 |
aataccttcataatgagaaaattatatatataggtattgt |
240 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27122462 |
aataccttcatgatgagaaaattatatatataggtattgt |
27122423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 240 - 273
Target Start/End: Complemental strand, 27122396 - 27122363
Alignment:
| Q |
240 |
tatcttctttatatttcaaattaaactacatatc |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27122396 |
tatcttctttatatttcaaattaaactacatatc |
27122363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University