View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14777_low_16 (Length: 277)
Name: NF14777_low_16
Description: NF14777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14777_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 161 - 260
Target Start/End: Original strand, 28243866 - 28243965
Alignment:
| Q |
161 |
gttatcagggtgatctttgtttagagagagtgaagtgcatgatttgatttagtatcagttaaaatgtatctgtagcaaagatggctagatcgggtgggat |
260 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28243866 |
gttaccagggtgatctttgtttagagagagtgaagtgaatgatttgatttggtatcagttaaaatgtatctgtagcaaagatggctagatcgggtgggat |
28243965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 19 - 64
Target Start/End: Original strand, 28243724 - 28243769
Alignment:
| Q |
19 |
atttcttcatcatttactccattttacttgatcttacctatttatc |
64 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28243724 |
atttcttcatcatttactccattttacttgatcttacctatttatc |
28243769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University