View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14777_low_18 (Length: 257)
Name: NF14777_low_18
Description: NF14777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14777_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 107; Significance: 1e-53; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 32598293 - 32598146
Alignment:
| Q |
1 |
tgggtagagatattgaatgaataattttggacatatgttcttgtcattagtatggttgcaattgaacagaatatacatatagctttagaattaaaatttt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
32598293 |
tgggtggagatattgaatgaataattttggacatatgttcttatcattagtatggttgcaattgaacaaaatatacatatagctttagaattaaaatatt |
32598194 |
T |
 |
| Q |
101 |
tatagatttataacacaaaaatgata----gataaaaaagatggtagc |
144 |
Q |
| |
|
||||||||| ||| |||||||||||| |||||||||||||||||| |
|
|
| T |
32598193 |
tatagatttgtaagacaaaaatgatagatagataaaaaagatggtagc |
32598146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 195 - 248
Target Start/End: Complemental strand, 32598144 - 32598091
Alignment:
| Q |
195 |
gatgtggtggcggcatagtactatcgtccttctaactatatacgtgagaatatt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
32598144 |
gatgtggtggcggcatagtactatcgtccttctaactatatacttgagaatatt |
32598091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 32603444 - 32603403
Alignment:
| Q |
1 |
tgggtagagatattgaatgaataattttggacatatgttctt |
42 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
32603444 |
tgggtagatatattgaatgaataatttaggacatatgttctt |
32603403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University