View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14778_high_12 (Length: 297)
Name: NF14778_high_12
Description: NF14778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14778_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 19 - 293
Target Start/End: Original strand, 26714301 - 26714582
Alignment:
| Q |
19 |
gtgcaggagtatgagtttaggagaccatt-------tatggttttgatgccttatcaaagtgaaataattcagtgagtgagagaagaatagagggagaaa |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||| || |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
26714301 |
gtgcaggagtataagtttaggagaccatcaaaatcataaggttttgatgccttatcaaagtgaaataattcagcgagggagagaagaatagagggagaaa |
26714400 |
T |
 |
| Q |
112 |
gactgaaatctaataatcagattttatcattttttaacctggatatatatttatagagagttatctttagatactgtctaatatgaccagctgtgataca |
211 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26714401 |
gactgaaatccaataatcagattttatcattttttaacctggatatatatttatagagagttatctctagatactgtctaatatgaccagctgtgataca |
26714500 |
T |
 |
| Q |
212 |
aagaagactatgtcaccgtagtgttaggtccaactctttaattatgtgtatcataaagacagttttattcgggacctttgct |
293 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
26714501 |
aagaagactatgtcaccgcagtgttaggtccaactctttaattatgtgtctcataaagacagttttattcgcgacctttgct |
26714582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University