View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14778_low_25 (Length: 238)
Name: NF14778_low_25
Description: NF14778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14778_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 225
Target Start/End: Original strand, 47470108 - 47470312
Alignment:
| Q |
21 |
agcgtatgtgatgagcgtgttggtgacggttacggaggcgagaacggctttggtggaggaaggagggataccggtgttggtggagattgtggaggttggg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47470108 |
agcgtatgtgatgagcgtgttggtgacggttacggaggcgagaacggctttggcggaggaaggagggataccggtgttggtggagattgtggaggttggg |
47470207 |
T |
 |
| Q |
121 |
acgcagagacataaggaaattgcggcggcgattttgttgaagatttgtgaagagaatgtgagttatcgtgtaatggtgtgtcgtgaaggtgctattcctc |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47470208 |
acgcagagacagaaggaaattgcggcggcgattttgttgaagatttgtgaagagaatgtgagttatcgtgtaatggtgtgtcgtgaaggtgctattcctc |
47470307 |
T |
 |
| Q |
221 |
ctttg |
225 |
Q |
| |
|
||||| |
|
|
| T |
47470308 |
ctttg |
47470312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 70 - 173
Target Start/End: Complemental strand, 5220618 - 5220515
Alignment:
| Q |
70 |
ttggtggaggaaggagggataccggtgttggtggagattgtggaggttgggacgcagagacataaggaaattgcggcggcgattttgttgaagatttgtg |
169 |
Q |
| |
|
|||||||||||||| || | ||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||| ||| |||| ||||||||| |
|
|
| T |
5220618 |
ttggtggaggaaggtggtgtgccggtgttggttgagattgtggaggttggatcgcagagacagaaggaaattgcggcggttattctgttacagatttgtg |
5220519 |
T |
 |
| Q |
170 |
aaga |
173 |
Q |
| |
|
|||| |
|
|
| T |
5220518 |
aaga |
5220515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University