View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14778_low_25 (Length: 238)

Name: NF14778_low_25
Description: NF14778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14778_low_25
NF14778_low_25
[»] chr3 (1 HSPs)
chr3 (21-225)||(47470108-47470312)
[»] chr1 (1 HSPs)
chr1 (70-173)||(5220515-5220618)


Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 21 - 225
Target Start/End: Original strand, 47470108 - 47470312
Alignment:
21 agcgtatgtgatgagcgtgttggtgacggttacggaggcgagaacggctttggtggaggaaggagggataccggtgttggtggagattgtggaggttggg 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
47470108 agcgtatgtgatgagcgtgttggtgacggttacggaggcgagaacggctttggcggaggaaggagggataccggtgttggtggagattgtggaggttggg 47470207  T
121 acgcagagacataaggaaattgcggcggcgattttgttgaagatttgtgaagagaatgtgagttatcgtgtaatggtgtgtcgtgaaggtgctattcctc 220  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47470208 acgcagagacagaaggaaattgcggcggcgattttgttgaagatttgtgaagagaatgtgagttatcgtgtaatggtgtgtcgtgaaggtgctattcctc 47470307  T
221 ctttg 225  Q
    |||||    
47470308 ctttg 47470312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 70 - 173
Target Start/End: Complemental strand, 5220618 - 5220515
Alignment:
70 ttggtggaggaaggagggataccggtgttggtggagattgtggaggttgggacgcagagacataaggaaattgcggcggcgattttgttgaagatttgtg 169  Q
    |||||||||||||| ||  | ||||||||||| |||||||||||||||||  |||||||||| ||||||||||||||||  ||| ||||  |||||||||    
5220618 ttggtggaggaaggtggtgtgccggtgttggttgagattgtggaggttggatcgcagagacagaaggaaattgcggcggttattctgttacagatttgtg 5220519  T
170 aaga 173  Q
    ||||    
5220518 aaga 5220515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University