View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14778_low_28 (Length: 232)
Name: NF14778_low_28
Description: NF14778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14778_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 218
Target Start/End: Original strand, 52384768 - 52384976
Alignment:
| Q |
10 |
agaagcaaaggtatatggaactag-accttgcaatttgtatttcatattgttagataaggaatagcttgtatccattgtttacttggacatatgttgtgt |
108 |
Q |
| |
|
|||| ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52384768 |
agaatcaagggtatatggaactagtaccttgcaatttgtatttcatattgttagataaggaatagcttgtatccattgtttacttggacatatgttgtgt |
52384867 |
T |
 |
| Q |
109 |
ctgaattcctttcttcaaggagaatataaagaaaggaactctctttatggttgcttacacatggaattgccaaacctttttggatgatgaatgttttggc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52384868 |
ctgaattcctttcttcaaggagaatataaagaaaggaactctctttatggttgcttacacatggaattgccaaacc-ttttggatgatgaatgttttggc |
52384966 |
T |
 |
| Q |
209 |
attcattcat |
218 |
Q |
| |
|
|||||||||| |
|
|
| T |
52384967 |
attcattcat |
52384976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University