View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1477_high_28 (Length: 216)
Name: NF1477_high_28
Description: NF1477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1477_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 48 - 205
Target Start/End: Complemental strand, 13021522 - 13021358
Alignment:
| Q |
48 |
gactaaaattttggtttacatgttaaga-------tacatattaaggactaatctccatcaaaaaattgtgaggcacacaatgtaagttatcctcactca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13021522 |
gactaaaattttggtttacatgttaagaattaagatacatattaaggactaatctccatcagaaaattgtgaggcacacaatgtaagttatcctcactca |
13021423 |
T |
 |
| Q |
141 |
atcaaattttcttttgaagagtcaatcgaacatttcaccacttaagtaacgtgtcaaagtttcat |
205 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13021422 |
atcaaattttctcttgaagagtcaatcgaacatttcaccacttaagtaacgtgtcaaagtttcat |
13021358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University