View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1477_high_6 (Length: 398)
Name: NF1477_high_6
Description: NF1477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1477_high_6 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (2 HSPs) |
 |  |  |
|
| [»] scaffold0187 (4 HSPs) |
 |  |  |
|
| [»] scaffold0057 (5 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0954 (1 HSPs) |
 |  |  |
|
| [»] scaffold0194 (2 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0116 (1 HSPs) |
 |  |  |
|
| [»] scaffold0167 (1 HSPs) |
 |  |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 326; Significance: 0; HSPs: 78)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 13 - 366
Target Start/End: Original strand, 16735242 - 16735595
Alignment:
| Q |
13 |
aatatattgttgaactctgaatttgaggctcatgttgctgattttggacttgctaagttcttgcaagataatgggaattcagaatgcatgtcttctattg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16735242 |
aatatattgttgaactctgaatttgaggctcatgttgctgattttggacttgctaagttcttgcaagataatgggaattcagaatgcatgtcttctattg |
16735341 |
T |
 |
| Q |
113 |
ctggttcttatggatatattgctccaggtacatactttaatacaaaattctcaaatatataaaatcattttcattgaggggtaaccttggcgcaactggt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16735342 |
ctggttcttatggatatattgctccaggtacatactttaatacaaaattctcaaatatataaaatcattttcattgaggggtaaccttggcgcaactggt |
16735441 |
T |
 |
| Q |
213 |
aaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtg |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
16735442 |
aaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccaaatggtg |
16735541 |
T |
 |
| Q |
313 |
ggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| |||||| |||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
16735542 |
ggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgccct |
16735595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 40272994 - 40272814
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||| |||||| |||||||| ||||| ||||||| |
|
|
| T |
40272994 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggta |
40272895 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40272894 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
40272814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 201 - 366
Target Start/End: Original strand, 26869696 - 26869861
Alignment:
| Q |
201 |
ggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||| |||||||||||| |||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
26869696 |
ggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctctggtgtaaaaacagggtaaggctgcgtacaata |
26869795 |
T |
 |
| Q |
301 |
caccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
26869796 |
caccaaatggtgggaccccttgccggaccatgcgtatgcgggagctttggtgcaccgggttgccct |
26869861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 186 - 366
Target Start/End: Original strand, 22609741 - 22609920
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
22609741 |
ttgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactgtaaggtaacgggttcaagtcttggaaacagcctcttgtgtaaaaacagggta |
22609839 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22609840 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccct |
22609920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 1217065 - 1217243
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||| || |||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
1217065 |
tgaggggtaaccttggcgcaactggtaaagttgtagtcatgtcactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaa |
1217163 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
1217164 |
ggctgcgtacaatacaccaaatggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
1217243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 13628975 - 13628792
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaa-gttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaa-aaacagggt |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||||||||||| || |||||||||||||||||| ||||||||||||||| || ||||||||| |
|
|
| T |
13628975 |
tgaggggtaaccttggcacaactggtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggt |
13628876 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13628875 |
aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
13628792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 39203491 - 39203669
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||| || ||||| |||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
39203491 |
tgaggggtaaccttggcacaacttgtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtccttgaaacagcctcttgt-gtaaaacagggtaa |
39203589 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||| ||||||| ||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
39203590 |
ggttgcgtacaatacaccaaatggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgccct |
39203669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 13730785 - 13730604
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
13730785 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
13730686 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
13730685 |
ggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
13730604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 189 - 366
Target Start/End: Complemental strand, 29366902 - 29366722
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgta-gaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
29366902 |
aggggtaaccttggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaag |
29366803 |
T |
 |
| Q |
288 |
gctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||||||| |||||| |||||||||| |
|
|
| T |
29366802 |
gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcactgggttgccct |
29366722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 46421218 - 46421036
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
46421218 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
46421119 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagcttt-ggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
46421118 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttaagtgcaccggtttgccct |
46421036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 8247871 - 8247688
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
8247871 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
8247772 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagcttt-ggtgcaccgggttgccct |
366 |
Q |
| |
|
||| ||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
8247771 |
aggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagctttaagtgcactgggttgccct |
8247688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 192 - 366
Target Start/End: Complemental strand, 22123092 - 22122919
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctg |
291 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||| || ||| |||||||||||||| ||||||| ||||||| | ||||||||||||||||| |
|
|
| T |
22123092 |
ggtaaccttggcgccactggtaaatttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacagtctcttgt-gtaaaacagggtaaggctg |
22122994 |
T |
 |
| Q |
292 |
cgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| |||||| ||||| | ||||||||||||||||| |
|
|
| T |
22122993 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgccct |
22122919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 52926391 - 52926221
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||||| |
|
|
| T |
52926391 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgta--------gtaag |
52926300 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
52926299 |
gctgcgtacaatacaccaaatggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccct |
52926221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 188 - 357
Target Start/End: Complemental strand, 6412002 - 6411833
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||| | |||| ||||||||||| | |||||||||||||| |||||||||||||| |
|
|
| T |
6412002 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtaactgataggtcatgggttcaagtcttgtaaacagcctcttgtgtaaaaacagggtaag |
6411903 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccg |
357 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| || |||| |||||||||||||||||| |||||||| |
|
|
| T |
6411902 |
gctgcgtacaatacaccaaatgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcaccg |
6411833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 12914216 - 12914037
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||| | || ||||| ||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
12914216 |
gaggggtaaccttggcgcaactggtaaagttgttgtaatgtgaccgaaaggtcacaagttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
12914117 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| |||||||||||||| ||||||| |||||||| || |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
12914116 |
ggcggcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgccct |
12914037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 186 - 366
Target Start/End: Complemental strand, 5173904 - 5173721
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaa-gttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggt |
284 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||||||||||||||||| || |||||||||||||||||| |||||| |||||||| ||||||| || |
|
|
| T |
5173904 |
ttgaggggtaaccttggcgcaactcgtaaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaacaaagt |
5173805 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| ||| | ||||||||| ||||||||| |||||| ||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5173804 |
aaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgccct |
5173721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 186 - 366
Target Start/End: Complemental strand, 7697068 - 7696894
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||| ||||||| | ||||||||||| |
|
|
| T |
7697068 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactaaaaggtcacgggttcaagtcctggaaacagtctcttgt-gtaaaacagggta |
7696970 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| ||||| |||||| |||||| |||| |||| ||||||| | |||||||||||| |||| |
|
|
| T |
7696969 |
aggctgcgtacaatacaccaaatgg-----ccccttcccggacactgcatatgtgggagctctagtgcaccgggtttccct |
7696894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 26573103 - 26573282
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggta |
285 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||| ||||||| || |||||||||||||||||| ||||||||||| ||| |||| |||||||| |
|
|
| T |
26573103 |
tgagggggacccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaacagggta |
26573201 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| | |||||||||||| | |||||||||||||||||| ||||||| ||||||| || |||||| |
|
|
| T |
26573202 |
aggctgcgtacaatacaccaattggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccaggctgccct |
26573282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 188 - 295
Target Start/End: Complemental strand, 10870132 - 10870025
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
10870132 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaag |
10870033 |
T |
 |
| Q |
288 |
gctgcgta |
295 |
Q |
| |
|
|||||||| |
|
|
| T |
10870032 |
gctgcgta |
10870025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 4495845 - 4495678
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||| || |||||||||||||||||| ||| ||||| |||| ||||||||||||| |
|
|
| T |
4495845 |
gaggggtaaccttcgcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctgaaaatagcctattgtgtaaaaaacagggtaa |
4495746 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4495745 |
ggctgcgtacaatacaccaaatggtg------------ggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
4495678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 241 - 366
Target Start/End: Original strand, 31592878 - 31593002
Alignment:
| Q |
241 |
acgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcg |
340 |
Q |
| |
|
||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||| |||| ||||||||||| |||||| |
|
|
| T |
31592878 |
acgggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatggtgggactccttcccggaccctgcatatgcg |
31592976 |
T |
 |
| Q |
341 |
ggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| | ||||||||||||||||| |
|
|
| T |
31592977 |
ggagctctagtgcaccgggttgccct |
31593002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 197 - 355
Target Start/End: Complemental strand, 34420815 - 34420656
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| | |||||||||||||| ||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34420815 |
ccttggcgcaacag-taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgta |
34420717 |
T |
 |
| Q |
296 |
caatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
| ||||||| |||||||||||||||| ||||||| |||||||| ||||||||| |||||| |
|
|
| T |
34420716 |
ccatacaccaaaatggtgggaccccttcccggaccttgcgtatgtgggagctttagtgcac |
34420656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 187 - 348
Target Start/End: Original strand, 9607178 - 9607342
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggt |
284 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| || |||| |||||||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
9607178 |
tgaggggtaaccttggcgcaacttgtaaagttgttgtcatgtgactgaaaggtcatcggttcaagtcctggaaacagcctcttgcgta-aaaaacagggt |
9607276 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||||||| || ||||| || |||||||||||||| |
|
|
| T |
9607277 |
aaggctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagcttt |
9607342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 252 - 366
Target Start/End: Original strand, 54484730 - 54484846
Alignment:
| Q |
252 |
tcctcgaaacagcctcttgt--agaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
|||| ||||||||||||||| | ||||||| ||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54484730 |
tcctggaaacagcctcttgtgtaaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttta |
54484829 |
T |
 |
| Q |
350 |
gtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
54484830 |
gtgcaccgggttgccct |
54484846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 220 - 366
Target Start/End: Original strand, 516417 - 516567
Alignment:
| Q |
220 |
ttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa---tggtggga |
315 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| ||||||||||||||| ||||| ||||||||||||||| |||||| ||| || ||| |||| |
|
|
| T |
516417 |
ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgcacaataaaccaaaaaatggcggga |
516516 |
T |
 |
| Q |
316 |
ccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
516517 |
ccccttccccgaccctgcgtatgcgggagctttagtgcaccgggttgccct |
516567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 189 - 366
Target Start/End: Complemental strand, 25517353 - 25517172
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagt--cctcgaaacagcctcttgt--agaaaaacagggt |
284 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| || ||||| || | | | ||| |||||| |||||||| | ||||||| | | |
|
|
| T |
25517353 |
agggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggatgatgggacctggaaacatcctcttgtgtaaaaaaacaagat |
25517254 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||| ||||| ||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
25517253 |
atggctgcgtacaatacacaaaatggtgggaccccttcccggatcctgcgtatgctggagctttagtgcaccgggttgccct |
25517172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 215 - 364
Target Start/End: Original strand, 7942993 - 7943143
Alignment:
| Q |
215 |
agttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaatggtgg |
313 |
Q |
| |
|
||||||||||||||||||| || ||||||| |||||||||| |||||||| |||||| |||| |||||||||| |||||||||||||| | |||||||| |
|
|
| T |
7942993 |
agttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcatcttgtctaaaaaacagggtaagactgcgtacaatacatcaaatggtgg |
7943092 |
T |
 |
| Q |
314 |
gaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|| ||||| || |||| |||||||||||||||||| |||||| |||||||| |
|
|
| T |
7943093 |
gatccctttccagaccatgcgtatgcgggagctttagtgcactgggttgcc |
7943143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 240 - 366
Target Start/End: Complemental strand, 10795554 - 10795425
Alignment:
| Q |
240 |
cacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgta |
336 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||| || |||||||||||||| | |||||||||||| |
|
|
| T |
10795554 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaagacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgta |
10795455 |
T |
 |
| Q |
337 |
tgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |
|
|
| T |
10795454 |
tgcgggagcttcagtgcaccaggttgccct |
10795425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 187 - 315
Target Start/End: Complemental strand, 45621010 - 45620881
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggt |
284 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||| ||||||| || ||||||||||||||| || |||||||||||| |||| ||||||||||| |
|
|
| T |
45621010 |
tgagggggagccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaaaacagggt |
45620912 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtggga |
315 |
Q |
| |
|
|||||||||||||||||||| | |||||||| |
|
|
| T |
45620911 |
aaggctgcgtacaatacaccaattggtggga |
45620881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 197 - 358
Target Start/End: Complemental strand, 45949012 - 45948848
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgta---acgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgc |
292 |
Q |
| |
|
|||||||||||| ||| |||||||| ||||||||||| | | ||||||||||||| |||| |||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
45949012 |
ccttggcgcaac-ggtgaagttgttttcatgtgactgaaggaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaatagggtaaggctgc |
45948914 |
T |
 |
| Q |
293 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||||||||||| | |||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
45948913 |
atacaatacaccaattggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgg |
45948848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 197 - 366
Target Start/End: Complemental strand, 53996737 - 53996567
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
||||||||| || |||||| |||||||||| |||||| || |||||| ||||||||| | |||||| |||||||| ||||| |||||||||||||| || |
|
|
| T |
53996737 |
ccttggcgctac-ggtaaatttgttgtcatttgactgaaaggtcacgtgttcaagtcgtggaaacaacctcttgtgtaaaaaacagggtaaggctgctta |
53996639 |
T |
 |
| Q |
296 |
caatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| || |||||||||||||| || ||| ||||||||| ||||||||| |||||||||| |||||| |
|
|
| T |
53996638 |
caatacaccaaaatggtgggaccccttccctgacactgcgtatgtgggagctttagtgcaccgggctgccct |
53996567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 261 - 366
Target Start/End: Original strand, 15797271 - 15797375
Alignment:
| Q |
261 |
cagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggt |
360 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||| ||||||| | ||||||||||| |
|
|
| T |
15797271 |
cagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggt |
15797369 |
T |
 |
| Q |
361 |
tgccct |
366 |
Q |
| |
|
|||||| |
|
|
| T |
15797370 |
tgccct |
15797375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 275 - 366
Target Start/End: Complemental strand, 34771457 - 34771366
Alignment:
| Q |
275 |
aaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | |||||||||| |||||| |
|
|
| T |
34771457 |
aaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggctgccct |
34771366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 244 - 366
Target Start/End: Original strand, 14986989 - 14987114
Alignment:
| Q |
244 |
ggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcg |
340 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||| | |||||||||||| || ||||||| ||| |||||| |
|
|
| T |
14986989 |
ggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcg |
14987088 |
T |
 |
| Q |
341 |
ggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| |||||||||||| |||| |
|
|
| T |
14987089 |
ggagctttagtgcaccgggtttccct |
14987114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 223 - 348
Target Start/End: Original strand, 33926094 - 33926220
Alignment:
| Q |
223 |
tcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacacc-gaatggtgggacccctt |
321 |
Q |
| |
|
||||||||||| || |||| ||||||||||||| |||| |||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
33926094 |
tcatgtgactgaaaggtcatgggttcaagtcctggaaatagcctcttgtgtaaaaacagggtaaggctgtgtacaatacaccataatggtgggacccctt |
33926193 |
T |
 |
| Q |
322 |
gccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
| ||||||||| |||||| ||||||| |
|
|
| T |
33926194 |
cctggaccctgcatatgcgagagcttt |
33926220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 197 - 366
Target Start/End: Original strand, 25944455 - 25944625
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggtaaggctgcgt |
294 |
Q |
| |
|
|||||||||||| | |||||||||||||| ||||||| || |||| ||||||||||||| ||||| |||||| |||| |||||| ||| ||||||| || |
|
|
| T |
25944455 |
ccttggcgcaacag-taaagttgttgtcacgtgactgaaaggtcatgggttcaagtcctggaaaccgcctctcgtgta-aaaaactgggcaaggctgagt |
25944552 |
T |
 |
| Q |
295 |
acaatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| |||||||||||||||| || ||||||||||||| ||||||||| | ||||| || |||||| |
|
|
| T |
25944553 |
acaatacaccaaaatggtgggaccccttccctgaccctgcgtatgtgggagctttagcgcaccaggctgccct |
25944625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 214 - 349
Target Start/End: Complemental strand, 30928302 - 30928166
Alignment:
| Q |
214 |
aagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaatacaccgaatggtg |
312 |
Q |
| |
|
||||| |||||||||||||| || |||||||||||||||||| ||||||||||||||| ||||||| ||||||| || ||| |||||||| | ||| | |
|
|
| T |
30928302 |
aagttcttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaaggtaaggttgtgtaaaatacaccaattggcg |
30928203 |
T |
 |
| Q |
313 |
ggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
30928202 |
ggaccccttcccggaccctgcatatgtgggagctttg |
30928166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 258 - 366
Target Start/End: Complemental strand, 45786327 - 45786216
Alignment:
| Q |
258 |
aaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||||||||| || |||||||||||||| |||||||||||| |||| |||||||| ||||| |
|
|
| T |
45786327 |
aaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgca |
45786228 |
T |
 |
| Q |
355 |
ccgggttgccct |
366 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45786227 |
ccgggttgccct |
45786216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 274 - 366
Target Start/End: Complemental strand, 353445 - 353351
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
353445 |
aaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 223 - 366
Target Start/End: Complemental strand, 54032705 - 54032573
Alignment:
| Q |
223 |
tcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggacccctt |
321 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54032705 |
tcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgcatacaatacaccgaatggtggg------- |
54032613 |
T |
 |
| Q |
322 |
gccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54032612 |
-----accctgcgtatgcgggagctttagtgcaccgggttgccct |
54032573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 257 - 366
Target Start/End: Complemental strand, 49013587 - 49013475
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgc |
353 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||||| | ||||||||||||||| |||||||| || || ||||||||||| |||| |
|
|
| T |
49013587 |
gaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgc |
49013488 |
T |
 |
| Q |
354 |
accgggttgccct |
366 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49013487 |
accgggttgccct |
49013475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 258 - 337
Target Start/End: Original strand, 47624088 - 47624167
Alignment:
| Q |
258 |
aaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
337 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |||| |
|
|
| T |
47624088 |
aaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgtgtat |
47624167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 210 - 364
Target Start/End: Original strand, 19731000 - 19731155
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||| ||||||||| |||| || || ||||||| | |||||||| |||| |||||||||| ||||| || ||||||| ||||||||||||||| | | |
|
|
| T |
19731000 |
ggtaaatttgttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggttgcgtacaatacacctatt |
19731099 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||||||| || || ||| ||| |||||| |||||||| |||||||||| |||| |
|
|
| T |
19731100 |
ggtgggaccctttcccagactctgtgtatgcaggagctttagtgcaccgggctgcc |
19731155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 223 - 366
Target Start/End: Complemental strand, 45139624 - 45139480
Alignment:
| Q |
223 |
tcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacacc--gaatggtgggacccc |
319 |
Q |
| |
|
||||||||||| || ||||||||||||||| | |||||| |||||||| |||| ||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
45139624 |
tcatgtgactgaaaggtcacgggttcaagttttggaaacaacctcttgtgtaaaacacagggtaaggctgcatacaatacaccaaaaatggtgggacccc |
45139525 |
T |
 |
| Q |
320 |
ttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| || || ||||||||||||||| |||| |||||||||| |||||| |
|
|
| T |
45139524 |
ttcccaga-cctgcgtatgcgggaacttt-gtgcaccgggctgccct |
45139480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 227 - 348
Target Start/End: Complemental strand, 54374488 - 54374365
Alignment:
| Q |
227 |
gtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgcc |
324 |
Q |
| |
|
||||||| || ||||| |||||||||| | |||||| |||||||| ||||| |||||||||||||||||||| |||| || |||||||||||||| || |
|
|
| T |
54374488 |
gtgactgaaaggtcacaggttcaagtcttggaaacaacctcttgtgtaaaaaatagggtaaggctgcgtacaatccaccaaaatggtgggaccccttccc |
54374389 |
T |
 |
| Q |
325 |
ggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||||||| |||||||||||||| |
|
|
| T |
54374388 |
ggaccctgcatatgcgggagcttt |
54374365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 187 - 293
Target Start/End: Original strand, 12525385 - 12525489
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| |||||| || ||||| ||||| |||||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
12525385 |
tgaggggtaaccttggcgcaactggtaaa---gttgtcatatgactgaaaggtcacaggttcgagtcctggaaacagcctcttgtgtaaaaatcagggta |
12525481 |
T |
 |
| Q |
286 |
aggctgcg |
293 |
Q |
| |
|
|||||||| |
|
|
| T |
12525482 |
aggctgcg |
12525489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 186 - 366
Target Start/End: Original strand, 33235504 - 33235686
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac-tgtaacgtcacgggttcaagtcctcgaaacagcctcttgt--agaaaaacagg |
282 |
Q |
| |
|
||||| || ||||||| ||| |||||||||||||||||||||||| || || ||||| |||||| || | ||| |||||||||| | ||||||||| |
|
|
| T |
33235504 |
ttgagcggaaaccttgatgcagctggtaaagttgttgtcatgtgacatgaaaggtcacaagttcaaatcgtgtaaagagcctcttgtgtaaaaaaacagg |
33235603 |
T |
 |
| Q |
283 |
gtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||||||| | | |||| | ||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
33235604 |
gtaagactgtgtacaatacactaaatggtgggacccctcg-cagaccttacgtatgcggaagctttagtgcaccaggttgccct |
33235686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 274 - 348
Target Start/End: Original strand, 9276327 - 9276400
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||| || ||||||||||||||||||||| |||| |
|
|
| T |
9276327 |
aaaaacagggtaaggctgcgtacaatacaccaaatggt-ggaccctttcccggaccctgcgtatgcgggaacttt |
9276400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 199 - 358
Target Start/End: Complemental strand, 829611 - 829452
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaa-aacagggtaaggctgcgtaca |
297 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| || || | | || |||||||| || |||||| |||||||| ||| |||| |||| | |||||||| |
|
|
| T |
829611 |
ttggcgcaac-ggtaaagttgttgtcacgtgattgaaa-gacccgagttcaagttctagaaacaacctcttgtctaaagaacatagtaaagttgcgtaca |
829514 |
T |
 |
| Q |
298 |
atacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||||||| || |||||||||||||| ||| ||||||||||||| |||||||| ||||||||| |
|
|
| T |
829513 |
atacaccaaaatggtgggaccccttcccgaaccctgcgtatgcaggagctttagtgcaccgg |
829452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 218 - 349
Target Start/End: Complemental strand, 8411016 - 8410886
Alignment:
| Q |
218 |
tgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggacc |
317 |
Q |
| |
|
|||||||||| ||||| || ||||| |||||| ||||| ||||| ||||| |||| ||||||||||||||||||| |||||||||| | |||||||||| |
|
|
| T |
8411016 |
tgttgtcatgggactgaaaggtcaccggttcaggtcctggaaactgcctcgtgta-aaaaacagggtaaggctgctcacaatacaccaactggtgggacc |
8410918 |
T |
 |
| Q |
318 |
ccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
||| | |||||||| || |||| ||||||| |
|
|
| T |
8410917 |
tcttctcagaccctgcataggcggaagctttg |
8410886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 245 - 354
Target Start/End: Complemental strand, 43114994 - 43114882
Alignment:
| Q |
245 |
gttcaagtcctcgaaacagcctcttgt--agaaaaacagggtaagg-ctgcgtacaatacaccgaatggtgggaccccttgccggaccc-tgcgtatgcg |
340 |
Q |
| |
|
||||||||||| ||||||||||||||| | ||||||||||||||| || | ||||||||||| ||||||||||||| || | |||||| |||||||||| |
|
|
| T |
43114994 |
gttcaagtcctggaaacagcctcttgtgtaaaaaaacagggtaagggctacctacaatacaccaaatggtgggaccc-ttcctggacccctgcgtatgcg |
43114896 |
T |
 |
| Q |
341 |
ggagctttggtgca |
354 |
Q |
| |
|
|||||||| ||||| |
|
|
| T |
43114895 |
ggagctttagtgca |
43114882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 244 - 364
Target Start/End: Original strand, 55401208 - 55401330
Alignment:
| Q |
244 |
ggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgg |
341 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||| |||| |||| ||||||| |||||||| || |||||||||||||| |||||| | ||||||||| |
|
|
| T |
55401208 |
ggttcaagtcctgtaaacagcctcttgtgtaaaaaacaggttaagactgcgtataatacaccaaaatggtgggaccccttctcggaccttccgtatgcgg |
55401307 |
T |
 |
| Q |
342 |
gagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||||| ||||||||| |||| |
|
|
| T |
55401308 |
gagcttttttgcaccgggctgcc |
55401330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 191 - 303
Target Start/End: Original strand, 21874999 - 21875106
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggtaagg |
288 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||| | || |||||| ||||| ||| ||||| ||||||||| |
|
|
| T |
21874999 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactg-------acgggttcaaattctggaaacaacctcttgtgttaaaaaagagggtaagg |
21875091 |
T |
 |
| Q |
289 |
ctgcgtacaatacac |
303 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
21875092 |
ctgcgtacaatacac |
21875106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 197 - 364
Target Start/End: Complemental strand, 44403727 - 44403559
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgta |
295 |
Q |
| |
|
|||||| ||||| ||||||||| |||||| ||| || || ||||| |||| ||||||| | || |||||||||| |||| ||| |||||||||||| | |
|
|
| T |
44403727 |
ccttggtgcaac-ggtaaagttattgtcacgtggctaaaaggtcacaggttaaagtcctgggaatagcctcttgtgtaaaagacaaggtaaggctgcgga |
44403629 |
T |
 |
| Q |
296 |
caatac-accgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||| || |||||||||||||||| ||||||||| ||||||| | |||||| |||||||||| |||| |
|
|
| T |
44403628 |
gaataccacaaaatggtgggaccccttcccggaccctacgtatgctgaagctttagtgcaccgggctgcc |
44403559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 306 - 366
Target Start/End: Complemental strand, 24851363 - 24851303
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
24851363 |
aatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccct |
24851303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 210 - 364
Target Start/End: Original strand, 19751576 - 19751731
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||| || |||||| |||| || || ||||||| | |||||||| |||| |||||||||| ||||| || ||||||| ||||||||||||||| | | |
|
|
| T |
19751576 |
ggtaaattttttgtcacgtgattgaaaggtcacggatgcaagtcctggaaatagcctcttgtgtaaaaatcaaggtaaggttgcgtacaatacacctatt |
19751675 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||||||| || || ||| || |||||| ||||||| |||||||||| |||| |
|
|
| T |
19751676 |
ggtgggaccctttcccagactttgtgtatgcatgagctttagtgcaccgggctgcc |
19751731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 308 - 366
Target Start/End: Original strand, 30452892 - 30452950
Alignment:
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
30452950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 313 - 366
Target Start/End: Complemental strand, 10484671 - 10484618
Alignment:
| Q |
313 |
ggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10484671 |
ggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
10484618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 250 - 366
Target Start/End: Complemental strand, 50625072 - 50624955
Alignment:
| Q |
250 |
agtcctcgaaacagcctcttgtaga-aaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||| ||||||||||||||| | |||| ||||||||| |||||||||||||| ||||||||| |||| | || ||||||||| | ||||||||| |
|
|
| T |
50625072 |
agtcctagaaacagcctcttgtgtataaaaaagggtaaggtagcgtacaatacaccatttggtgggacgccttcctgggccctgcgtaagtgggagcttt |
50624973 |
T |
 |
| Q |
349 |
ggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
50624972 |
agtgcaccgggctgccct |
50624955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 210 - 267
Target Start/End: Original strand, 53062036 - 53062093
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctc |
267 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| ||||||||||| ||||||||||| |
|
|
| T |
53062036 |
ggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcctggaaacagcctc |
53062093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 262 - 362
Target Start/End: Original strand, 26292382 - 26292481
Alignment:
| Q |
262 |
agcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggtt |
361 |
Q |
| |
|
|||||||||| | ||||||||||||| | |||||| ||||||| |||| ||||| ||||| ||| ||||||| ||||||||| || | |||||||||||| |
|
|
| T |
26292382 |
agcctcttgt-gtaaaacagggtaagaccgcgtacgatacaccaaatgatgggatcccttcccgaaccctgcatatgcgggaactctagtgcaccgggtt |
26292480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 323 - 366
Target Start/End: Original strand, 47624211 - 47624254
Alignment:
| Q |
323 |
ccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47624211 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
47624254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 197 - 271
Target Start/End: Original strand, 35417902 - 35417975
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||| | |||||| |||||| |||| ||||||||||||||| |
|
|
| T |
35417902 |
ccttggcgcaac-ggtaaagttgttatcatgtgactgagaggtcacgagttcaaatcctggaaacagcctcttgt |
35417975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 274 - 366
Target Start/End: Complemental strand, 31904951 - 31904858
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtggga-ccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||| | |||||||||||||||| |||||||||| |||||| || || | | ||| |||||||||||| ||||||| || |||||| |
|
|
| T |
31904951 |
aaaaacagggtatgactgcgtacaatacaccaaatggtgggacccccttcccagatcttacgtgtgcgggagctttagtgcaccaggctgccct |
31904858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 214 - 302
Target Start/End: Original strand, 39211992 - 39212081
Alignment:
| Q |
214 |
aagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaa-aacagggtaaggctgcgtacaataca |
302 |
Q |
| |
|
||||||| || ||||||||| || |||||||||||||||||| |||| | |||||||| ||| |||| |||||| |||||||||||||| |
|
|
| T |
39211992 |
aagttgtcgttatgtgactgaaatgtcacgggttcaagtcctggaaataacctcttgtgtaaataacaaggtaagactgcgtacaataca |
39212081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 187 - 227
Target Start/End: Original strand, 9276249 - 9276289
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatg |
227 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9276249 |
tgaggggtaaccttggcgcaactagtaaagttgttgtcatg |
9276289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 191 - 271
Target Start/End: Original strand, 26782345 - 26782425
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
||||||||||| ||||| |||||||||| |||||||| || || || ||||||| |||||||||| |||||| ||||||| |
|
|
| T |
26782345 |
gggtaaccttgacgcaattggtaaagttattgtcatgcgattgaaaggtcacggattcaagtccttgaaacaatctcttgt |
26782425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 238 - 359
Target Start/End: Complemental strand, 52428609 - 52428479
Alignment:
| Q |
238 |
gtcacgggttcaagtc-ctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaatggtgg-------gaccccttgccggac |
328 |
Q |
| |
|
|||||||||| ||||| || ||| ||||||||||| |||| ||||||||||||||||||||||||||| ||| |||| ||||||| ||||| |
|
|
| T |
52428609 |
gtcacgggtttaagtctctggaagcagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatagtggaaccccaaaccccttctcggac |
52428510 |
T |
 |
| Q |
329 |
cctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||| |||||| ||||||||| |||||||||| |
|
|
| T |
52428509 |
cctacgtatgtgggagctttagtgcaccggg |
52428479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 210 - 366
Target Start/End: Original strand, 28904941 - 28905098
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa--acagggtaaggctgcgtacaatacaccgaa |
307 |
Q |
| |
|
||||||||||||||||||||||| || ||||| ||| |||||| | ||||| ||||||| |||| ||| |||||| ||| ||||| |||||| || |
|
|
| T |
28904941 |
ggtaaagttgttgtcatgtgactaaaaagtcacatgtttaagtccagggaacagtctcttgtgtaaaataacaaggtaagactgtgtacattacaccaaa |
28905040 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||||| || |||||||||||||| |||||| |||| ||| | |||| |||||| |
|
|
| T |
28905041 |
ta-tgggaccctttcccggaccctgcgtaagcgggaactttagtgtaacgggctgccct |
28905098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 327 - 366
Target Start/End: Original strand, 40390357 - 40390396
Alignment:
| Q |
327 |
accctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40390357 |
accctgcgtatgcgggagctttagtgcaccgggttgccct |
40390396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 191 - 228
Target Start/End: Original strand, 23871418 - 23871455
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgt |
228 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
23871418 |
gggtaaccttggcgcaactagtaaagttgttgtcatgt |
23871455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 327 - 366
Target Start/End: Complemental strand, 14266413 - 14266374
Alignment:
| Q |
327 |
accctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
14266413 |
accctgcgtatgcgggagctttagtgcactgggttgccct |
14266374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 257 - 366
Target Start/End: Original strand, 31831244 - 31831341
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||| ||||||||||| |||||| ||||||||||| |||||||| ||| | ||||||| |
|
|
| T |
31831244 |
gaaacagcctcttgt-gtaaaatagggtaaggctgcatacaatacaccaaatggt-----------ccggaccctgcatatgcgggtgctctagtgcacc |
31831331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 329 - 366
Target Start/End: Original strand, 23871484 - 23871521
Alignment:
| Q |
329 |
cctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
23871484 |
cctgcgtatgcgggaactttagtgcaccgggttgccct |
23871521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 293 - 366
Target Start/End: Original strand, 24577917 - 24577990
Alignment:
| Q |
293 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| |||||||||| || || || |||||||| ||| |||||||| | ||||||||| ||||||| |
|
|
| T |
24577917 |
gtacaatacactaaatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgccct |
24577990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 293 - 366
Target Start/End: Original strand, 24578007 - 24578080
Alignment:
| Q |
293 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| ||||||||||| | || || |||||| | ||||||||| || | ||||||||||||||||| |
|
|
| T |
24578007 |
gtacaatacactaaatggtgggactctttcccagaccctacatatgcgggaactctagtgcaccgggttgccct |
24578080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 325 - 366
Target Start/End: Complemental strand, 43956515 - 43956474
Alignment:
| Q |
325 |
ggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| |||||| |
|
|
| T |
43956515 |
ggacccagcgtatgcgggagctttagtgcaccgggctgccct |
43956474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 39430465 - 39430509
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgact |
232 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
39430465 |
gaggggtaactttgacgcaactggtaaagttgctgtcatctgact |
39430509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 144; Significance: 1e-75; HSPs: 100)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 5648212 - 5648391
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
5648212 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaa |
5648311 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
5648312 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgccct |
5648391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 186 - 366
Target Start/End: Complemental strand, 6430808 - 6430628
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
6430808 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcatggaaacagcctcttgtgtaaaaacagggta |
6430709 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
6430708 |
aggctgcgtacaatacaccaaatggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccct |
6430628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 186 - 366
Target Start/End: Original strand, 20224936 - 20225115
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||| |||||| |||||||| | ||||||||||| |
|
|
| T |
20224936 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacaacctcttgt-gtaaaacagggta |
20225034 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
20225035 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
20225115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 48599005 - 48598827
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
48599005 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaa |
48598907 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| ||| ||||| |||||| | ||||||||||||||||| |
|
|
| T |
48598906 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgccct |
48598827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 30639333 - 30639512
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| || ||||| |||||||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
30639333 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcttgtgactgaaaggtcactggttcaagtcctggaaacagactcttgtgtaaaaacagggtaa |
30639432 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||| ||||||||||| |||||||||||||| |||||| |||||||||| |
|
|
| T |
30639433 |
ggctgcgtacaatacaccaaatggtgagaccccttcccggaccctgcatatgcgggagctttagtgcactgggttgccct |
30639512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 5306845 - 5306662
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| || |||||||||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
5306845 |
tgaggggtaaccttggcgcaactggtaaagttgatgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaatcagggtaa |
5306746 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatg----cgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||| |||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
5306745 |
ggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgtggacgggagctttaatgcaccgggttgccct |
5306662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 47528709 - 47528532
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| || ||||| |||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
47528709 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaag |
47528611 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||| |||| ||||||| | ||||||||||||||||| |
|
|
| T |
47528610 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccct |
47528532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 207 - 366
Target Start/End: Original strand, 40915802 - 40915961
Alignment:
| Q |
207 |
actggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccga |
306 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||||||||||| | |
|
|
| T |
40915802 |
actggtaaagttgttgtcatgtgactataaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacaaggtaaggctgcgtacaatacaccaa |
40915901 |
T |
 |
| Q |
307 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
40915902 |
atggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccct |
40915961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 11054327 - 11054150
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||| ||||||| | ||||||||||||| |
|
|
| T |
11054327 |
gaggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctgaaaacagtctcttgt-gtaaaacagggtaag |
11054229 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| ||||| || ||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
11054228 |
actgcgtacaatacaccaaatggcggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
11054150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 195 - 366
Target Start/End: Complemental strand, 16408777 - 16408603
Alignment:
| Q |
195 |
aaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcg |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
16408777 |
aaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagactgcg |
16408678 |
T |
 |
| Q |
294 |
tacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| |||||||| ||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
16408677 |
tacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
16408603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 191 - 366
Target Start/End: Original strand, 16911519 - 16911697
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtaga-aaaacagggtaaggc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||| ||||||||||| |
|
|
| T |
16911519 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgacttaaaggtcacgggttcaagtcctagaaacagcctcttgtgtacaaatcagggtaaggc |
16911618 |
T |
 |
| Q |
290 |
tgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| ||||||||||| || ||||||||||||| |
|
|
| T |
16911619 |
tgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagctttagtttaccgggttgccct |
16911697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 23501747 - 23501922
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||||| ||||| |||||||| |
|
|
| T |
23501747 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtc------acagcctcttgtgtaaaaaacagggtaa |
23501840 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| ||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
23501841 |
ggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
23501922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 188 - 365
Target Start/End: Original strand, 21646918 - 21647098
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
21646918 |
gagggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaa |
21647017 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||| || ||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
21647018 |
ggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 226 - 366
Target Start/End: Complemental strand, 29208039 - 29207900
Alignment:
| Q |
226 |
tgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccg |
325 |
Q |
| |
|
|||||||| || |||||||||||||||||| |||| ||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
29208039 |
tgtgactgaaaggtcacgggttcaagtcctggaaattgcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccg |
29207941 |
T |
 |
| Q |
326 |
gaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
29207940 |
gaccctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 188 - 354
Target Start/End: Original strand, 37494805 - 37494972
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||| ||||| || ||||| |||||||||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
37494805 |
gaggggtaaccttggtgcaactggtaaagttgttgccatgcgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa |
37494904 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
|| ||| ||||||| ||| |||||||||||||||| | ||||||||||||||| |||||||| ||||| |
|
|
| T |
37494905 |
ggttgcatacaatataccaaatggtgggacccctttcgggaccctgcgtatgcaggagctttagtgca |
37494972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 207 - 366
Target Start/End: Complemental strand, 44363294 - 44363132
Alignment:
| Q |
207 |
actggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccg |
305 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||| ||||||||||| |||||||||| ||| ||||| ||||||| |||||||||||| |||| |
|
|
| T |
44363294 |
actggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctgaaaacagcctcgtgtgtaaaaaacagggtagggctgcgtacaacgcacca |
44363195 |
T |
 |
| Q |
306 |
aa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44363194 |
aaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
44363132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 214 - 366
Target Start/End: Original strand, 54175043 - 54175198
Alignment:
| Q |
214 |
aagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaa-cagcctcttgtagaaaaacagggtaaggctgcgtacaatacacc-gaatggt |
311 |
Q |
| |
|
|||||||||||||||||||| || ||||||| |||||||||| |||| ||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
54175043 |
aagttgttgtcatgtgactgaaatgtcacggattcaagtcctggaaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaaatggt |
54175142 |
T |
 |
| Q |
312 |
gggacccctt-gccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| |||||||||| |||||| |
|
|
| T |
54175143 |
gggaccccttccccggaccctgcatatgcgggagctttagtgcaccgggctgccct |
54175198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 55766647 - 55766468
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacggg-ttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| | || |||||||| ||||||| | ||||||| |||||| ||||||||||| |
|
|
| T |
55766647 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgaccggaaggtcacggggttcaagttttggaaacagtttcttgtgtgtaaacagggtaa |
55766548 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| | ||||||| |||||||||| ||||||| |||||||||| |||||| |
|
|
| T |
55766547 |
ggctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccgggatgccct |
55766468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 212 - 366
Target Start/End: Complemental strand, 9832468 - 9832315
Alignment:
| Q |
212 |
taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggt |
311 |
Q |
| |
|
|||| ||||||| || |||||| || |||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9832468 |
taaaattgttgtgatctgactgaaaggtcacgggttcaagtcctgaaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatggt |
9832370 |
T |
 |
| Q |
312 |
gggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||| || | ||||||||||||||||| |
|
|
| T |
9832369 |
gggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgccct |
9832315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 199 - 366
Target Start/End: Complemental strand, 8473790 - 8473622
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| | || || |||||||||||||| ||||||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
8473790 |
ttggcgcaactggtaaagttgttgtcatatgaccggaaggttgcgggttcaagtcctggaaacagcctcttgt-gtttaacagggtaaggctgcatacaa |
8473692 |
T |
 |
| Q |
299 |
tacaccgaatggtgggacccctt-gccgga-ccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| |||||||||||||||| ||||| |||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
8473691 |
tacaccaaatggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccct |
8473622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 187 - 317
Target Start/End: Original strand, 14590790 - 14590922
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttg--tagaaaaacagggt |
284 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
14590790 |
tgagtggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggt |
14590889 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggacc |
317 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||| |
|
|
| T |
14590890 |
aaggctgcatacaatacatcaaatggtgggacc |
14590922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 191 - 366
Target Start/End: Original strand, 14983791 - 14983967
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggc |
289 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||| || || ||||||| |||||||| | ||||||||||||||| ||||| ||||||||| |
|
|
| T |
14983791 |
gggtaaccttggcagaactggtaaagttgttgtcatatgattggaaggtcacggattcaagtctttgaaacagcctcttgtgtaaaaaatagggtaaggt |
14983890 |
T |
 |
| Q |
290 |
tgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| |||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
14983891 |
tgcctacaatacactaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccatgttgccct |
14983967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 193 - 366
Target Start/End: Complemental strand, 30352767 - 30352582
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt------agaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| | || |||||||||| |||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
30352767 |
gtaaccttggcgcaactggtaaagttgttgtcaagtgaccgaaaggtcacgggttagagtcctggaaacagcctcttgtgtaaaaaaaaaaacagggtaa |
30352668 |
T |
 |
| Q |
287 |
g----gctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| ||||||||||||||||| || |||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
30352667 |
gtaaagctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcaccgtgttgccct |
30352582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 13256578 - 13256401
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| || |||| |||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
13256578 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcataggttcaagtcctgg----agcctcttgtgtaaaaaacagggtaa |
13256483 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| ||| |||| || | |||||||||||| ||||||||||||||||| |
|
|
| T |
13256482 |
ggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgccct |
13256401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 210 - 366
Target Start/End: Original strand, 35567146 - 35567303
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
||||||||||||||||||| |||| || |||| ||||||||||| | ||||||||| ||||| |||| |||||||||||||| |||||| ||||| ||| |
|
|
| T |
35567146 |
ggtaaagttgttgtcatgtaactgaaaggtcatgggttcaagtcttggaaacagccacttgtgtaaaaaacagggtaaggctgtgtacaacacaccaaat |
35567245 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| ||| ||||||||| |||||||||||| |||||||||| |||||| |
|
|
| T |
35567246 |
ggtgggaccccttcccgaaccctgcgtctgcgggagctttagtgcaccgggctgccct |
35567303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 215 - 364
Target Start/End: Complemental strand, 39077948 - 39077800
Alignment:
| Q |
215 |
agttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtggg |
314 |
Q |
| |
|
|||||||||||||||| || || |||||||||||||||||| ||||||||||||||| | |||||||||||||| ||||||||||| ||| ||||||| | |
|
|
| T |
39077948 |
agttgttgtcatgtgattgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaaggttgcgtacaatataccaaatggtgag |
39077850 |
T |
 |
| Q |
315 |
accccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|| ||| ||||||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
39077849 |
acatctttccggaccctgcatatgcgggagctctagtgcaccgggttgcc |
39077800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 186 - 357
Target Start/End: Original strand, 54730201 - 54730376
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacaggg |
283 |
Q |
| |
|
|||| ||||||| ||||||||| |||||||||||||||||||||| || |||||||||||||||||| |||||||||||| |||| ||||| ||| |
|
|
| T |
54730201 |
ttgatgggtaactttggcgcaatcggtaaagttgttgtcatgtgaccaaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaaatagga |
54730300 |
T |
 |
| Q |
284 |
taaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccg |
357 |
Q |
| |
|
|||||||||||| |||||||| |||| ||| ||||||| |||||||||||||||||||||||||| |||||||| |
|
|
| T |
54730301 |
taaggctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccg |
54730376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 214 - 348
Target Start/End: Complemental strand, 17043549 - 17043414
Alignment:
| Q |
214 |
aagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaatggtg |
312 |
Q |
| |
|
|||||||||||| ||||||| || ||||| |||||||||||| ||||||||||||||| |||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
17043549 |
aagttgttgtcaagtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaatacagggtaaggctgcgtacaatacaccaaatggtg |
17043450 |
T |
 |
| Q |
313 |
ggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||||||| || |||||||| ||||| |||||||| |
|
|
| T |
17043449 |
ggaccccttcccagaccctgcatatgctggagcttt |
17043414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 238 - 366
Target Start/End: Original strand, 47443961 - 47444090
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttg--tagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgt |
335 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| | |
|
|
| T |
47443961 |
gtcacgggttcaagtcctggaaacagcctcttgcgta-aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcat |
47444059 |
T |
 |
| Q |
336 |
atgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| ||||||| |||||| |||||||||| |
|
|
| T |
47444060 |
atgcaggagcttcagtgcactgggttgccct |
47444090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 55830902 - 55830723
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgg-gttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||| | || ||||||| |||||||| | ||||||| ||||||| ||||||||||| |
|
|
| T |
55830902 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgatcggaaggtcacggagttcaagttttggaaacagtctcttgtgtgtaaacagggtaa |
55830803 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| | ||||||| |||||||||| ||||||| ||||||| || |||||| |
|
|
| T |
55830802 |
tgctgcgtacaatacactgaatggtggaaccccatcccggaccttgcgtatgcgagagctttagtgcaccaggatgccct |
55830723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 209 - 358
Target Start/End: Original strand, 19027823 - 19027973
Alignment:
| Q |
209 |
tggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaa |
307 |
Q |
| |
|
||||| ||||||||||| ||||||| || |||||||||||||||||| |||||| | |||||| |||| ||||||||||||||||||||||||||| | |
|
|
| T |
19027823 |
tggtagagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacatcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaat |
19027922 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
|||||||||||||| || ||| ||||||||| ||||||||| ||||||||| |
|
|
| T |
19027923 |
tggtgggacccctttccagactctgcgtatgtgggagctttagtgcaccgg |
19027973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 251 - 366
Target Start/End: Complemental strand, 20639777 - 20639660
Alignment:
| Q |
251 |
gtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
20639777 |
gtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaaaatggtgggaccccttcccggaccctgcgtatgcgggagcttt |
20639678 |
T |
 |
| Q |
349 |
ggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
20639677 |
agtgcaccgggttgccct |
20639660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 20405047 - 20405222
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt--agaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| || |||||||| ||| ||||||||||||||| | |||||||||||| |
|
|
| T |
20405047 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgactggaaggtcacggg-------cctagaaacagcctcttgtgtaaaaaaacagggta |
20405139 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| |||||||||||||| | ||||||||||||||| |||||||| || |||||||||||||| ||||| |||||||||| |
|
|
| T |
20405140 |
agattgcgtacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttgccct |
20405222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 212 - 366
Target Start/End: Complemental strand, 30690340 - 30690178
Alignment:
| Q |
212 |
taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa--------cagggtaaggctgcgtacaatacac |
303 |
Q |
| |
|
|||||| ||||||| ||||||| || |||||||||||||||||| |||| |||||||||| ||||| |||||||||||||| |||||||||| |
|
|
| T |
30690340 |
taaagtggttgtcaagtgactgaaaggtcacgggttcaagtcctggaaaaagcctcttgtgtaaaaaataaaaaacagggtaaggctgcatacaatacac |
30690241 |
T |
 |
| Q |
304 |
cgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| | |||||||||||||| |||||||||||||||||||||||||| ||||||| || |||||| |
|
|
| T |
30690240 |
caattggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgccct |
30690178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 220 - 349
Target Start/End: Original strand, 25463108 - 25463238
Alignment:
| Q |
220 |
ttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggaccc |
318 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||| |||||| |||||||| ||||| | ||| |||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
25463108 |
ttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaactgggaaaggttgcgtacaacacaccaaatggtgggaccc |
25463207 |
T |
 |
| Q |
319 |
cttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
||| ||||||||||| ||||||||||||||| |
|
|
| T |
25463208 |
cttcccggaccctgcatatgcgggagctttg |
25463238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 212 - 366
Target Start/End: Complemental strand, 32478942 - 32478794
Alignment:
| Q |
212 |
taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggt |
311 |
Q |
| |
|
|||||||||||||||||||| | | ||||| |||||||||||| |||||| ||||| || |||||||||||||||||| |||||||| |||||| |
|
|
| T |
32478942 |
taaagttgttgtcatgtgaccgagaggtcacaggttcaagtcctggaaacaacctctagtgtaaaaacagggtaaggctg-----aatacaccaaatggt |
32478848 |
T |
 |
| Q |
312 |
gggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
32478847 |
gggaccccttcccggacccagcgtatgcgggagcttt-gtgcaccgggtggccct |
32478794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 191 - 292
Target Start/End: Complemental strand, 17315476 - 17315375
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggct |
290 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||| ||||||||||| |||||||| ||||||| ||||||||| |
|
|
| T |
17315476 |
gggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgggttcaattcctcgaaacaacctcttgtgtaaaaacaaggtaaggct |
17315377 |
T |
 |
| Q |
291 |
gc |
292 |
Q |
| |
|
|| |
|
|
| T |
17315376 |
gc |
17315375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 189 - 365
Target Start/End: Original strand, 54966977 - 54967151
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaag |
287 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||| || ||||| |||||||| || |||| | |||||||| ||||| ||||||||| |
|
|
| T |
54966977 |
agggggaaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacatgttcaagttctggaaagaacctcttgtgtaaaaaacagggtaag |
54967075 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
| ||| ||||||| ||| |||||||||||||||| ||| ||||| | |||||||||||||| |||||||||| ||||| |
|
|
| T |
54967076 |
gttgc-tacaatataccaaatggtgggaccccttcccgtaccctacatatgcgggagcttt-gtgcaccgggctgccc |
54967151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 188 - 365
Target Start/End: Original strand, 10660358 - 10660538
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || || || ||||||||||| |||||| ||||| |||| ||||| |||||| |
|
|
| T |
10660358 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgta-aaaaatagggta |
10660456 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagcttt-ggtgcaccgggttgccc |
365 |
Q |
| |
|
|||||| ||||||||||| ||||||| |||||||| | || |||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
10660457 |
tggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgccc |
10660538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 188 - 365
Target Start/End: Original strand, 10874503 - 10874683
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || || || ||||||||||| |||||| ||||| |||| ||||| |||||| |
|
|
| T |
10874503 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggttacatgttcaagtcctggaaacaacctcttatgta-aaaaatagggta |
10874601 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagcttt-ggtgcaccgggttgccc |
365 |
Q |
| |
|
|||||| ||||||||||| ||||||| |||||||| | || |||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
10874602 |
tggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagctttaagtgcatcgggttgccc |
10874683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 34 - 142
Target Start/End: Complemental strand, 40404007 - 40403899
Alignment:
| Q |
34 |
tttgaggctcatgttgctgattttggacttgctaagttcttgcaagataatgggaattcagaatgcatgtcttctattgctggttcttatggatatattg |
133 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||| ||| | ||| |||||||||||| |||||||||||||||||||||| || | |
|
|
| T |
40404007 |
tttgaagcccatgttgctgattttggacttgctaagttcttgcaagattctggaacttctgaatgcatgtctgctattgctggttcttatggatacatag |
40403908 |
T |
 |
| Q |
134 |
ctccaggta |
142 |
Q |
| |
|
||||||||| |
|
|
| T |
40403907 |
ctccaggta |
40403899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 199 - 358
Target Start/End: Complemental strand, 47441699 - 47441540
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtaca |
297 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| || ||||| ||||||||||| ||||||| ||||| | ||||| ||||||||||||| ||||| |
|
|
| T |
47441699 |
ttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtccaagaaacagtctcttttgtaaaaatcagggtaaggctgtgtaca |
47441601 |
T |
 |
| Q |
298 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||||||| |||||| ||||||||| |||||||||| ||| || |||||||| || |||||| |
|
|
| T |
47441600 |
atacaccaaatggttggaccccttcccggaccctgagtaagcaggagctttcgtccaccgg |
47441540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 252 - 366
Target Start/End: Complemental strand, 7909397 - 7909282
Alignment:
| Q |
252 |
tcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgc-gggagctttgg |
350 |
Q |
| |
|
|||| ||||||| ||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||| ||| ||||||||||||| ||||||||| | |
|
|
| T |
7909397 |
tcctggaaacagtctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcggggagctttag |
7909298 |
T |
 |
| Q |
351 |
tgcaccgggttgccct |
366 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
7909297 |
tgcatcgggttgccct |
7909282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 198 - 357
Target Start/End: Complemental strand, 30496491 - 30496333
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtaca |
297 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| || |||||| ||||||||| | ||||||||||||||| ||| || |||||||||||| |||| |
|
|
| T |
30496491 |
cttggcgcaactgtaaaagttgttgtcacgtgactgaaaggtcacgtgttcaagtcatggaaacagcctcttgtgtaaacac-gggtaaggctgcataca |
30496393 |
T |
 |
| Q |
298 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccg |
357 |
Q |
| |
|
||||||| ||||| ||||| |||| ||||||| ||| |||| |||||||| |||||||| |
|
|
| T |
30496392 |
atacaccaaatggggggactccttcccggaccgtgcttatgatggagctttagtgcaccg |
30496333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 219 - 344
Target Start/End: Complemental strand, 32629418 - 32629293
Alignment:
| Q |
219 |
gttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaa-tggtgggacc |
317 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||||||||||||||||||||| |||||||||||||||| || ||| ||||||| || ||| |||||| |
|
|
| T |
32629418 |
gttgtcatgtgactgaaaggtcacgggttcaaatcctcgaaacagcctcttgtaaaaaaacagggtaaggccgcctac-atacaccaaattggcgggacc |
32629320 |
T |
 |
| Q |
318 |
ccttgccggaccctgcgtatgcgggag |
344 |
Q |
| |
|
|||| ||||||| |||||||| ||||| |
|
|
| T |
32629319 |
ccttcccggaccttgcgtatgtgggag |
32629293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 274 - 366
Target Start/End: Original strand, 25629090 - 25629182
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| |||||||||||| |||||||||||| |||||||||||||||| ||||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
25629090 |
aaaaatagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgccct |
25629182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 217 - 355
Target Start/End: Complemental strand, 41018945 - 41018807
Alignment:
| Q |
217 |
ttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggac |
316 |
Q |
| |
|
||||||||| ||||||| || |||||||||||||||||| |||||| |||||||| |||| ||||||||||| ||||||||||||| ||| ||||||| |
|
|
| T |
41018945 |
ttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaattagggtaaggctacgtacaatacaccaaatagtgggac |
41018846 |
T |
 |
| Q |
317 |
cccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
||||| || |||| |||||||| || ||||| |||||| |
|
|
| T |
41018845 |
cccttcccagaccttgcgtatggaggggctttagtgcac |
41018807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 257 - 347
Target Start/End: Original strand, 49796821 - 49796911
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctt |
347 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
49796821 |
gaaacagcctcttgtgttaaaacatggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctt |
49796911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 217 - 345
Target Start/End: Complemental strand, 7385628 - 7385499
Alignment:
| Q |
217 |
ttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgtacaatacaccgaatggtggga |
315 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| ||| ||||||||||| ||| ||||| ||||||||| || || ||||||||| |||||||||| |
|
|
| T |
7385628 |
ttgttgtcatgtgactgaaaggtcacgggttcaagccctggaaacagcctcatgtgtaaaaaatagggtaaggttgtgtgcaatacaccaaatggtggga |
7385529 |
T |
 |
| Q |
316 |
ccccttgccggaccctgcgtatgcgggagc |
345 |
Q |
| |
|
||| || |||||||||| |||||||||||| |
|
|
| T |
7385528 |
ccctttcccggaccctgtgtatgcgggagc |
7385499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 258 - 358
Target Start/End: Complemental strand, 51865149 - 51865048
Alignment:
| Q |
258 |
aaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
51865149 |
aaacagcctcttgtgtaaaaaacatggtaaggctgcgtacaatacaccaaatggtggggccccttcccggaccctgcgtatgcgggagctttattgcacc |
51865050 |
T |
 |
| Q |
357 |
gg |
358 |
Q |
| |
|
|| |
|
|
| T |
51865049 |
gg |
51865048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 278 - 366
Target Start/End: Original strand, 20225119 - 20225209
Alignment:
| Q |
278 |
acagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
20225119 |
acagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
20225209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 200 - 348
Target Start/End: Complemental strand, 49938759 - 49938613
Alignment:
| Q |
200 |
tggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaat |
299 |
Q |
| |
|
||||||||| | ||||||||||||| ||||||| || ||||| |||||||||||| ||||||||||||||| |||||| ||||||| | ||||||| |
|
|
| T |
49938759 |
tggcgcaacggtaaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacggggtaag---gtgtacaat |
49938663 |
T |
 |
| Q |
300 |
acacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||| |||||||||||||||| || ||||||| |||||||||||||| |
|
|
| T |
49938662 |
acaccaaaatggtgggaccccttcccataccctgcatatgcgggagcttt |
49938613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 246 - 363
Target Start/End: Original strand, 21489099 - 21489218
Alignment:
| Q |
246 |
ttcaagtcctcgaaacagcctcttg--tagaaaaacagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcggg |
342 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||||| ||||| ||||||||||| |||| || |||||||||||||| ||| |||||||||||||||| |
|
|
| T |
21489099 |
ttcaagtcctggaaacagcctcttgcgta-aaaaacagagtaagactgcgtacaatgcaccaaaatggtgggaccccttcccgaaccctgcgtatgcggg |
21489197 |
T |
 |
| Q |
343 |
agctttggtgcaccgggttgc |
363 |
Q |
| |
|
|||||| |||||| ||||||| |
|
|
| T |
21489198 |
agctttcgtgcactgggttgc |
21489218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 238 - 366
Target Start/End: Complemental strand, 10277886 - 10277759
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
337 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| |||| ||| ||||||||||||||||||||| ||||||| ||||||| || |||||||| ||| |
|
|
| T |
10277886 |
gtcacgggttcaaatccttgaaacagcctcttgtataaaat-aggataaggctgcgtacaatacaccaaatggtgaaaccccttcccagaccctgcatat |
10277788 |
T |
 |
| Q |
338 |
gcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| | | ||| ||||| ||||||| |
|
|
| T |
10277787 |
gcgggagttctagtgaaccggattgccct |
10277759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 210 - 348
Target Start/End: Complemental strand, 39029220 - 39029080
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa- |
307 |
Q |
| |
|
||||||||||||||| ||||||| || |||| |||||||| | | ||||||||||||||| ||||| ||||||||||||| ||||||||||| || |
|
|
| T |
39029220 |
ggtaaagttgttgtcgtgtgactaaaaggtcataggttcaagccttggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtacaatacacgaaaa |
39029121 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||||| ||| ||||||||||| |||||||||||||| |
|
|
| T |
39029120 |
tggtgggaccactttccggaccctgcatatgcgggagcttt |
39029080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 188 - 355
Target Start/End: Complemental strand, 20908818 - 20908649
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaac-gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggta |
285 |
Q |
| |
|
|||||| | ||||||| |||| |||||||||||||||||||||||| || || || ||||||||| | |||||| | |||| | ||||| | |||| |
|
|
| T |
20908818 |
gagggggagccttggcacaac-ggtaaagttgttgtcatgtgactgaaaatgttacatgttcaagtcatggaaacatcgtcttttctaaaaaagaaggta |
20908720 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
20908719 |
aggctgcgtacaatacaccaaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
20908649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 197 - 365
Target Start/End: Original strand, 36589708 - 36589876
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||||||| ||||| |||||| |||||| | |||||||||||| ||||||||||||||| ||||| || ||||| |||| | |
|
|
| T |
36589708 |
ccttggcgcaac-ggtaaagttgatgtcacatgactgaaacgtc-caggttcaagtcctggaaacagcctcttgtgtaaaaaacatggtaatgctgttga |
36589805 |
T |
 |
| Q |
296 |
caatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
|| |||||| || |||||||||||||| | | ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
36589806 |
cagtacaccaaaatggtgggaccccttcctgaaccctatgtatgcgggagctttggtgcaccgggctgccc |
36589876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 199 - 293
Target Start/End: Complemental strand, 42164317 - 42164224
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcg |
293 |
Q |
| |
|
|||||||||| |||||| ||||||||||||||||| || |||||||||||||||| | |||||| |||||||| |||||||||||||||||||| |
|
|
| T |
42164317 |
ttggcgcaac-ggtaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaacagggtaaggctgcg |
42164224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 197 - 359
Target Start/End: Complemental strand, 487306 - 487135
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtaga-aaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| || |||||||||||||||| | |||||| |||||||| | |||||| ||||| |||||||| |
|
|
| T |
487306 |
ccttggcgtaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaaacaaggtaaagctgcgta |
487208 |
T |
 |
| Q |
296 |
caatacac---------cgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
|||||||| | |||| |||||||||| ||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
487207 |
caatacactaaaatggtgggatggcgggaccccttcccggattctgcgaatgcgggagctttagtgcaccggg |
487135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 306 - 366
Target Start/End: Original strand, 11394925 - 11394985
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11394925 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
11394985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 306 - 366
Target Start/End: Original strand, 11404652 - 11404712
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11404652 |
aatggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
11404712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 306 - 366
Target Start/End: Complemental strand, 38755970 - 38755910
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38755970 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
38755910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 246 - 364
Target Start/End: Complemental strand, 9987957 - 9987838
Alignment:
| Q |
246 |
ttcaagtcctcgaaacagcctcttgtagaaa-aacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggag |
344 |
Q |
| |
|
|||||||||| |||||| |||||||| ||| || ||||||||||||| ||||||||||| |||||||||||||||| | |||| ||| |||||||||| |
|
|
| T |
9987957 |
ttcaagtcctggaaacaacctcttgtgtaaacaatagggtaaggctgcatacaatacaccaaatggtgggaccccttccttgaccttgcatatgcgggag |
9987858 |
T |
 |
| Q |
345 |
ctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||| ||||||||| |||| |
|
|
| T |
9987857 |
ctttaatgcaccgggctgcc |
9987838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 197 - 348
Target Start/End: Complemental strand, 30581638 - 30581485
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt--agaaaaacagggtaaggctgcgt |
294 |
Q |
| |
|
|||||||||||| | |||||||||||||| | ||| || |||| ||||||||||| | |||||| |||||||| | ||||||||||||||| || || |
|
|
| T |
30581638 |
ccttggcgcaac-gctaaagttgttgtcacatcactaaaaggtcaagggttcaagtcgtggaaacaacctcttgtgtaaaaaaacagggtaagggtgtgt |
30581540 |
T |
 |
| Q |
295 |
acaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||||| || |||||||||||||| ||||||||||| |||| |||||||| |
|
|
| T |
30581539 |
acaatacaccaaaatggtgggaccccttcccggaccctgcatatgtaggagcttt |
30581485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 211 - 349
Target Start/End: Complemental strand, 3580994 - 3580859
Alignment:
| Q |
211 |
gtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgtacaatacaccgaatg |
309 |
Q |
| |
|
||||||||||||||||||||||| || |||||| ||||||||| | ||||| ||||||| |||||| | |||||||||| || ||||||||| |||| |
|
|
| T |
3580994 |
gtaaagttgttgtcatgtgactgaaaagtcacgagttcaagtc-tggaaac---ctcttgtgtaaaaaccatggtaaggctgtgtgcaatacaccaaatg |
3580899 |
T |
 |
| Q |
310 |
gtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
| ||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
3580898 |
ctaggaccccttcccggaccctgcatatgtgggagctttg |
3580859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 297 - 366
Target Start/End: Original strand, 38786673 - 38786742
Alignment:
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
38786673 |
aatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
38786742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 306 - 366
Target Start/End: Complemental strand, 33836549 - 33836489
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
33836549 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccct |
33836489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 198 - 304
Target Start/End: Original strand, 25343152 - 25343258
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtac |
296 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||| | ||||| ||||||||| || |||| || ||||||| |||| ||||||||||||||||||| |
|
|
| T |
25343152 |
cttggcgcaa-tggtaaagttgttgtcacgtgactgataggtcacaggttcaagttctggaaatagtctcttgtgtaaaaaacagggtaaggctgcgtac |
25343250 |
T |
 |
| Q |
297 |
aatacacc |
304 |
Q |
| |
|
|||||||| |
|
|
| T |
25343251 |
aatacacc |
25343258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 366
Target Start/End: Original strand, 32484307 - 32484366
Alignment:
| Q |
307 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
32484366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 366
Target Start/End: Complemental strand, 40553998 - 40553939
Alignment:
| Q |
307 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40553998 |
atggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
40553939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 222 - 366
Target Start/End: Original strand, 7038041 - 7038185
Alignment:
| Q |
222 |
gtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaatacacc-gaatggtgggacccc |
319 |
Q |
| |
|
|||||||||||| || ||||| |||||||||||| |||||||| |||||| ||||| |||||||| || ||||||||||||| ||||||||| | || |
|
|
| T |
7038041 |
gtcatgtgactgaaaggtcacaggttcaagtcct-gaaacagcttcttgtgtaaaaaatagggtaagacttcgtacaatacaccaaaatggtggggcacc |
7038139 |
T |
 |
| Q |
320 |
ttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| ||||||||||||||| | |||||||| |||||| |||||||||| |
|
|
| T |
7038140 |
tacccggaccctgcgtatac-ggagctttagtgcactgggttgccct |
7038185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 191 - 264
Target Start/End: Complemental strand, 5313172 - 5313099
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagc |
264 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| || || ||||||||||||| |||| ||||||| |
|
|
| T |
5313172 |
gggtaaccttggcgtaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaattcctgaaaacagc |
5313099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 274 - 366
Target Start/End: Complemental strand, 36816479 - 36816386
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaat-ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| | |||||||||||||||||| || |||||||| |||| | |||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
36816479 |
aaaaacagggcagggctgcgtacaatacaccaaaaaggtgggactccttcctggaccctgtgtatgcgggagctttagtgtaccgggttgccct |
36816386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 306 - 366
Target Start/End: Original strand, 25388249 - 25388309
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
25388249 |
aatggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttgccct |
25388309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 306 - 354
Target Start/End: Complemental strand, 47482912 - 47482864
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47482912 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttggtgca |
47482864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 75
Target Start/End: Original strand, 26736016 - 26736062
Alignment:
| Q |
29 |
ctgaatttgaggctcatgttgctgattttggacttgctaagttcttg |
75 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26736016 |
ctgattttgaggctcatgttgctgattttggacttgctaagttcttg |
26736062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 191 - 231
Target Start/End: Original strand, 18969698 - 18969738
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgac |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18969698 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgac |
18969738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 212 - 366
Target Start/End: Complemental strand, 23580365 - 23580210
Alignment:
| Q |
212 |
taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaatacacc-gaatg |
309 |
Q |
| |
|
|||||||||||||| ||||||| || ||||||||||||||| || |||| |||||||||| |||||||||| ||| ||||||| ||||||| |||| |
|
|
| T |
23580365 |
taaagttgttgtcacgtgactgaaaggtcacgggttcaagttctagaaagagcctcttgtgtaaaaaacaggggaagactgcgtaggatacaccaaaatg |
23580266 |
T |
 |
| Q |
310 |
gtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| | |||||||| ||| |||| ||||| ||||||||| |||||||| | |||||| |
|
|
| T |
23580265 |
gcgagaccccttcttgga-cctgtgtatgtgggagctttagtgcaccgagctgccct |
23580210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 318 - 366
Target Start/End: Original strand, 35532077 - 35532125
Alignment:
| Q |
318 |
ccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35532077 |
ccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
35532125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 210 - 292
Target Start/End: Original strand, 43035224 - 43035307
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaa-aaacagggtaaggctgc |
292 |
Q |
| |
|
|||||||||||||||| ||||||| || ||||||||||||||||| |||||| |||||||| || ||||| ||||||||||| |
|
|
| T |
43035224 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtccaggaaacaacctcttgtgtaagaaacacggtaaggctgc |
43035307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 307 - 366
Target Start/End: Original strand, 44718641 - 44718700
Alignment:
| Q |
307 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| || ||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
44718641 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagcacaccgggttgccct |
44718700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 197 - 299
Target Start/End: Complemental strand, 49938610 - 49938508
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
|||||||||||| | ||||||||||||| ||||||| || ||||| | |||||||| | ||| |||| | |||| ||||||||||||||||||||| | |
|
|
| T |
49938610 |
ccttggcgcaacggtaaaagttgttgtcacgtgactgaaaggtcacagattcaagtcttggaagcagcgtattgtgtaaaaacagggtaaggctgcgtcc |
49938511 |
T |
 |
| Q |
297 |
aat |
299 |
Q |
| |
|
||| |
|
|
| T |
49938510 |
aat |
49938508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 197 - 271
Target Start/End: Complemental strand, 54640510 - 54640437
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
|||||||||||| |||||| ||||||||| ||| ||| || |||||||||||||||| | ||||||||||||||| |
|
|
| T |
54640510 |
ccttggcgcaac-ggtaaaattgttgtcacgtggctgaaaggtcacgggttcaagtcttggaaacagcctcttgt |
54640437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 269 - 366
Target Start/End: Complemental strand, 12711548 - 12711451
Alignment:
| Q |
269 |
tgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| ||||| |||||||| |||||||||||||||| ||||| |||||||||| | |||| |||||||||| | |||| ||||||| |||||||| |
|
|
| T |
12711548 |
tgtaaaaaaatagggtaagactgcgtacaatacaccaaatggcgggaccccttctcagacctagcgtatgcggaaactttagtgcacccagttgccct |
12711451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 189 - 265
Target Start/End: Complemental strand, 20373974 - 20373898
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcc |
265 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| |||| |||||| || ||||| |||||| |||| ||||||||| |
|
|
| T |
20373974 |
aggggtaactttggcgcaactggtcaagttgttctcatatgactgaaatgtcacatgttcaattccttgaaacagcc |
20373898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 306 - 366
Target Start/End: Complemental strand, 50555718 - 50555658
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| |||| ||| |||||||||| |||||| |
|
|
| T |
50555718 |
aatggtggaaccccttcccggaccctgcgtatgcaggagttttagtgcaccgggctgccct |
50555658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 275 - 349
Target Start/End: Original strand, 9037772 - 9037847
Alignment:
| Q |
275 |
aaaacagggtaaggctgcgtacaatacaccgaatggtgggacccc-ttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
|||| |||||||| |||| |||||||||||||||||| ||||||| || ||| || |||||||||| ||||||||| |
|
|
| T |
9037772 |
aaaatagggtaagactgcatacaatacaccgaatggtaggaccccttttccgaacactgcgtatgcaggagctttg |
9037847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 366
Target Start/End: Complemental strand, 12666914 - 12666859
Alignment:
| Q |
311 |
tgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||| |||||| ||||||||| |||||||| || |||||||||||||| |
|
|
| T |
12666914 |
tgggaccccttgtcggaccatgcgtatgcaggagctttagtacaccgggttgccct |
12666859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 275 - 359
Target Start/End: Original strand, 16494259 - 16494345
Alignment:
| Q |
275 |
aaaacagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
|||||||||||| ||||| ||||||||||| || ||||||||||| || || ||||||| |||||||| |||||| ||| |||||| |
|
|
| T |
16494259 |
aaaacagggtaaagctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagctttagtgtaccggg |
16494345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 197 - 271
Target Start/End: Complemental strand, 12257764 - 12257691
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
||||| |||||| |||||||||||||||| |||| || || ||||||||||||| |||| |||||||| |||||| |
|
|
| T |
12257764 |
ccttgacgcaac-ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaaatcctagaaacagcgtcttgt |
12257691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 277 - 366
Target Start/End: Original strand, 2813169 - 2813261
Alignment:
| Q |
277 |
aacagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagcttt-ggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| |||||||||||||| | | |||||||||||| || ||| || |||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
2813169 |
aacagggtaagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgccct |
2813261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 187 - 232
Target Start/End: Complemental strand, 29879679 - 29879634
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgact |
232 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||||||||||| |
|
|
| T |
29879679 |
tgaggggtaacattggtgcaactgataaagttgttgtcatgtgact |
29879634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 197 - 304
Target Start/End: Original strand, 51420537 - 51420645
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacggg-ttcaagtcctcgaaacagcctcttgtaga-aaaacagggtaaggctgcgt |
294 |
Q |
| |
|
|||||||||||| ||| |||||||||||| ||||||| || |||| | |||||||| | |||||| |||||||| | ||||||||||||||||| || |
|
|
| T |
51420537 |
ccttggcgcaac-ggtgaagttgttgtcacgtgactgaaaggtcagttgattcaagtcatggaaacaacctcttgtgtagaaaacagggtaaggctgggt |
51420635 |
T |
 |
| Q |
295 |
acaatacacc |
304 |
Q |
| |
|
|||||||||| |
|
|
| T |
51420636 |
acaatacacc |
51420645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 197 - 261
Target Start/End: Complemental strand, 50856407 - 50856344
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaac |
261 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||| || || |||||||||||||||||| ||||| |
|
|
| T |
50856407 |
ccttggcgcaac-ggtaaagttgttgtcacatgattgaaaggtcacgggttcaagtcctagaaac |
50856344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 274 - 366
Target Start/End: Complemental strand, 48327859 - 48327765
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| |||| ||||||||||| |||||||||||| ||| ||| |||| | ||||||| || ||| |||||||||||| |||| |
|
|
| T |
48327859 |
aaaaacagggtaagactgcatacaatacaccaataatggtgggacctcttcccgaaccccacatatgcggaagttttagtgcaccgggttaccct |
48327765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 308 - 366
Target Start/End: Original strand, 19027986 - 19028044
Alignment:
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| |||| |||||||| | |||||||||||||| |||||||||| |||||| |
|
|
| T |
19027986 |
tggtgggactccttcccggaccccacttatgcgggagctttagtgcaccgggctgccct |
19028044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 364
Target Start/End: Original strand, 28494224 - 28494282
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||||||||||||| || || ||||| |||||||||||| | |||||||||| |||| |
|
|
| T |
28494224 |
aatggtgggaccccttcccagatcctgcatatgcgggagctctagtgcaccgggctgcc |
28494282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 366
Target Start/End: Original strand, 56322984 - 56323033
Alignment:
| Q |
317 |
cccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| |||||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
56322984 |
cccttcccggaccccggatatgcgggagctttagtgcaccgggttgccct |
56323033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 306 - 354
Target Start/End: Original strand, 8820581 - 8820629
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||| ||| ||| ||||| |
|
|
| T |
8820581 |
aatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgca |
8820629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 274 - 337
Target Start/End: Complemental strand, 35894556 - 35894492
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtat |
337 |
Q |
| |
|
||||||| |||||| ||||||||||||||| || |||||||||||||| ||||| | ||||||| |
|
|
| T |
35894556 |
aaaaacacggtaagtgtgcgtacaatacaccaaaatggtgggaccccttcccggatcatgcgtat |
35894492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 140; Significance: 3e-73; HSPs: 63)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 13160655 - 13160834
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
13160655 |
tgaggggtaacctcggcgcaactggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaacagggtaa |
13160754 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
13160755 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgccct |
13160834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 186 - 366
Target Start/End: Complemental strand, 28817809 - 28817628
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggt |
284 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| ||||| |||||| |
|
|
| T |
28817809 |
ttgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt |
28817710 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
28817709 |
aaggctgcgtacaatacacccaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgccct |
28817628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 12670429 - 12670252
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
12670429 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaag |
12670331 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | |||||||||||| |||| |
|
|
| T |
12670330 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttaccct |
12670252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 185 - 366
Target Start/End: Complemental strand, 30454279 - 30454099
Alignment:
| Q |
185 |
attgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggt |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | |||||| ||| |
|
|
| T |
30454279 |
attgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacaaggt |
30454181 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
30454180 |
aaggctgcgtacgatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
30454099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 186 - 366
Target Start/End: Original strand, 36720748 - 36720929
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggt |
284 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |||| ||||||| |
|
|
| T |
36720748 |
ttgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggt |
36720847 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
36720848 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgccct |
36720929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 45071219 - 45071397
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||| ||||||||||||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
45071219 |
gaggggtaaccttggcgatactggtaaagttgttgtcatgtgattgtaaggtcacgggttcaagttctggaaacagcctcttgtgtaaaaacagggtaag |
45071318 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45071319 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccct |
45071397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 35261633 - 35261812
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| ||| ||||||| ||||||| |||| ||||||||| |
|
|
| T |
35261633 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagccctggaaacagtctcttgtgtaaaaaacagggtaa |
35261732 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35261733 |
ggttgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
35261812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 39461178 - 39460996
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||||||||| ||||||||||||||| |||||||| ||| |
|
|
| T |
39461178 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgagactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagta |
39461079 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39461078 |
aggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
39460996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 188 - 363
Target Start/End: Complemental strand, 29521866 - 29521690
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaa |
286 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |||||||| || |||||||||||||||||| ||||||||||||||| ||||| |||||||| |
|
|
| T |
29521866 |
gaggggtaaccttggcgcaactgataaagttgttgtcgtgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtttaaaaaacagggtaa |
29521767 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgc |
363 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| | || ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29521766 |
ggctgcgtacaatacaccaaatggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcaccgggttgc |
29521690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 188 - 362
Target Start/End: Original strand, 44530103 - 44530278
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| || |||||||||||||||| | |||||| |||||||| |||| ||||||||| |
|
|
| T |
44530103 |
gaggggtaaccttggcgcaactggtaaagttgctgtcatgtgactagaaggtcacgggttcaagtcttggaaacaacctcttgtgtaaaaaacagggtaa |
44530202 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
362 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44530203 |
ggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttg |
44530278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 183 - 364
Target Start/End: Complemental strand, 18164945 - 18164764
Alignment:
| Q |
183 |
tcattgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagg |
282 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| |||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
18164945 |
tcattgaggggtaatcttggcgcaaccggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagg |
18164846 |
T |
 |
| Q |
283 |
gtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||| ||||||||||||||| || | || |||| || |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18164845 |
gtaaggttgcgtacaatacaccaaaggatgtgaccatttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
18164764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 7136710 - 7136529
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||| |||||| |||||||| ||||| |||||||| |
|
|
| T |
7136710 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaccagggtaa |
7136611 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| || |||||||||||||| |||||||||||| |||| |
|
|
| T |
7136610 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttaccct |
7136529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 192 - 362
Target Start/End: Complemental strand, 20284250 - 20284075
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt---agaaaaacagggtaagg |
288 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||||| ||||||||| |
|
|
| T |
20284250 |
ggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaagggtaagg |
20284151 |
T |
 |
| Q |
289 |
ctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
362 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
20284150 |
ctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
20284075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 186 - 366
Target Start/End: Original strand, 17823528 - 17823709
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggt |
284 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| | || |||||||||||||||||| ||||||||||||||| ||||| |||| | |
|
|
| T |
17823528 |
ttgaggggtaatcttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaccaggat |
17823627 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| ||||||| |||||||| |||||||| ||||||| ||| ||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
17823628 |
aagactgcgtaaaatacaccaaatggtggaaccccttcccgaaccctgcatatgcaggagctttagtgcaccgggttgccct |
17823709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 192 - 362
Target Start/End: Complemental strand, 21070879 - 21070703
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt----agaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||||| |||||||| |
|
|
| T |
21070879 |
ggtaaccttgacgcaacgggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaaaaaaagggtaag |
21070780 |
T |
 |
| Q |
288 |
gctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
362 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
21070779 |
gctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttg |
21070703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 2626472 - 2626655
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt----agaaaaacagg |
282 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| | || |||||||||||||||||| ||||||||||||||| | ||||||||| |
|
|
| T |
2626472 |
tgaggggtaaccttggcgcaattggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaaaacagg |
2626571 |
T |
 |
| Q |
283 |
gtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||| || |||||||| ||||||||||||| ||||||| | ||||||| |
|
|
| T |
2626572 |
gtaagactgcgtacaatacaccaaatgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgccct |
2626655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 6760776 - 6760957
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| ||||| || |||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
6760776 |
tgaggggtaac-ttggcgcaactggtaaagttgttgtcatatgactagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
6760874 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||| ||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
6760875 |
aggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgccct |
6760957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 99; E-Value: 9e-49
Query Start/End: Original strand, 188 - 345
Target Start/End: Complemental strand, 20869677 - 20869523
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
20869677 |
gagggataaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaag |
20869579 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagc |
345 |
Q |
| |
|
|||| |||||||||||| | |||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
20869578 |
gctgtgtacaatacacc--aaggtgagaccccttcccggaccctgcatatgcgggagc |
20869523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 203 - 366
Target Start/End: Original strand, 12625858 - 12626023
Alignment:
| Q |
203 |
cgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt--agaaaaacagggtaaggctgcgtacaata |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||| | |||||||| ||||||||| |||||| |||||||| | |||||||||||||| |||| ||||||| |
|
|
| T |
12625858 |
cgcaactggtaaagttgttgtcgtgtgacttgtaggtcacgggctcaagtcctggaaacaacctcttgtgtaaaaaaacagggtaagactgcatacaata |
12625957 |
T |
 |
| Q |
301 |
caccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
12625958 |
caccaaatggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
12626023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 26954086 - 26954268
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggta |
285 |
Q |
| |
|
|||||||||| |||||| || |||||||||||||||||||||| | || |||||||||||||||||| |||||||||||| |||| |||||||||||| |
|
|
| T |
26954086 |
gaggggtaactttggcgtaattggtaaagttgttgtcatgtgattagaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaaacagggta |
26954185 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| || |||| || |||||||||||||| |||||| |||||||||| |
|
|
| T |
26954186 |
aggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcactgggttgccct |
26954268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 193 - 366
Target Start/End: Complemental strand, 8897940 - 8897766
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctg |
291 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||||||||| | || |||||||||| ||||||| |||||| || ||||| ||||| ||||||||||| |
|
|
| T |
8897940 |
gtaaccctggcacaactggtaaagttgttgtcatgtgacagcaaggtcacgggttgaagtcctggaaacaaccgcttgtgtaaaaaatagggtaaggcta |
8897841 |
T |
 |
| Q |
292 |
cgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
8897840 |
cgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccct |
8897766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 197 - 366
Target Start/End: Original strand, 28407379 - 28407536
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
28407379 |
ccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaagg-------- |
28407470 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| |||||||||||||||| ||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
28407471 |
----caccaaatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgccct |
28407536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 25250475 - 25250657
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||| || ||||| ||||||||||| |||||||||| |||| ||||| |||||| |
|
|
| T |
25250475 |
tgagaggtaaccttggcacaactggtaaagttgttgtcatgtgactggaaggtcacatgttcaagtcctggaaacagcctattgtgtaaaaaatagggta |
25250574 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||| |||| || |||||||||| ||| ||||||||||||||||| |
|
|
| T |
25250575 |
tggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgccct |
25250657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 211 - 349
Target Start/End: Complemental strand, 24365218 - 24365078
Alignment:
| Q |
211 |
gtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa--cagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||| ||| ||||||||||||||| ||||| ||||||||||||||| |||||||||| ||| |
|
|
| T |
24365218 |
gtaaagttgttgtcatgtgactaaaatgtcacgggttcaagccctagaaacagcctcttgtgtaaaaaatcagggtaaggctgcgaacaatacaccaaat |
24365119 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
24365118 |
ggtgggaccccttcccggaccctgcgtatgtgggagctttg |
24365078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 240 - 366
Target Start/End: Complemental strand, 5135418 - 5135292
Alignment:
| Q |
240 |
cacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatg |
338 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||| |||||||||||| |||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
5135418 |
cacgggttcaagtcctggaaacagcctcttgtgtaaaaaagagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatg |
5135319 |
T |
 |
| Q |
339 |
cgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||||| |||||||||| |||||| |
|
|
| T |
5135318 |
caggagcttt-gtgcaccgggctgccct |
5135292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 197 - 355
Target Start/End: Complemental strand, 44781677 - 44781517
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||| || ||||||||||||||||| |||||| |||||||| |||| |||||||||||||| ||| |
|
|
| T |
44781677 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaagttcacgggttcaagtcctggaaacaacctcttgtgtaaaagacagggtaaggctgtgta |
44781579 |
T |
 |
| Q |
296 |
caatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
||||||||| |||| ||||||||| | || ||||||||||||||||||||||| |||||| |
|
|
| T |
44781578 |
caatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 216 - 366
Target Start/End: Original strand, 31457155 - 31457305
Alignment:
| Q |
216 |
gttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtggga |
315 |
Q |
| |
|
|||||||||||||| ||| || |||||||||||||||||| ||||| |||||||| ||||| ||| |||||||||||||||||| | |||||| ||| |
|
|
| T |
31457155 |
gttgttgtcatgtggctgaaaggtcacgggttcaagtcctgtaaacaacctcttgtgtaaaaataggaaaaggctgcgtacaatacatcaaatggtagga |
31457254 |
T |
 |
| Q |
316 |
ccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| || |||||||||||||||||||| | ||||||||| ||||||| |
|
|
| T |
31457255 |
ccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccct |
31457305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 274 - 366
Target Start/End: Original strand, 29877135 - 29877227
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| || ||||||| || |||||| |
|
|
| T |
29877135 |
aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccaggctgccct |
29877227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 197 - 359
Target Start/End: Complemental strand, 8484109 - 8483947
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| ||||||| |||| || |||||| || |||| ||||||||||||| |||||| |||||||| ||||| ||||| ||||||||||| |
|
|
| T |
8484109 |
ccttggcgcaac-ggtaaagcggttgccacgtgacttaaatgtcatgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggcaaggctgcgta |
8484011 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||||||||| | |||||||||||| | || ||||||||||||||||||||||| | |||||||| |
|
|
| T |
8484010 |
caatacaccaattggtgggaccccatcccagaccctgcgtatgcgggagctttagggcaccggg |
8483947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 188 - 348
Target Start/End: Original strand, 24245405 - 24245564
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| ||||| | ||||| | ||||||||||| |
|
|
| T |
24245405 |
gaggggtaaccttggggcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaac-gtctcttat---gtaacagggtaag |
24245500 |
T |
 |
| Q |
288 |
gctgcgtacaatacacc---gaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|| |||||||| |||| ||| |||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
24245501 |
actacgtacaatgcaccaaaaaattgtgggaccccttcctggaccctgcgtatgcgggagcttt |
24245564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 238 - 358
Target Start/End: Original strand, 389647 - 389770
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgt---agaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcg |
334 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||| | ||||||||||||||| ||||||||||||||| |||| ||||| ||||| || ||||||||| |
|
|
| T |
389647 |
gtcacgggttcaagtcctggaaacaccctcttgtgtcaaaaaaacagggtaaggttgcgtacaatacaccaaatgatgggatccctttcctgaccctgcg |
389746 |
T |
 |
| Q |
335 |
tatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
|||||| ||||||| ||||||||| |
|
|
| T |
389747 |
tatgcgagagctttagtgcaccgg |
389770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 269 - 366
Target Start/End: Original strand, 10857865 - 10857962
Alignment:
| Q |
269 |
tgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| | |||||||||| ||| | ||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10857865 |
tgtaaaaaaacagggtaaggctgcgcacaatacaccaattggtgggaccacttcctggaccttgcgtatgcgggagctttagtgcaccgggttgccct |
10857962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 274 - 366
Target Start/End: Original strand, 20869964 - 20870058
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||| | |||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
20869964 |
aaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttgccct |
20870058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 210 - 356
Target Start/End: Original strand, 22598133 - 22598279
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||||||||||||| |||||| || ||||||||||||| |||| |||||| |||||||| |||| ||||||||||||| |||||||||||| | | |
|
|
| T |
22598133 |
ggtaaagttgttgtcacatgactgaaaggtcacgggttcaaatcctggaaacaacctcttgtgtaaaaaacagggtaaggctatgtacaatacaccaatt |
22598232 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
|||| ||||| || ||||||| ||||||||||||| |||| ||||||| |
|
|
| T |
22598233 |
ggtgagaccctttcccggaccttgcgtatgcggga-ctttagtgcacc |
22598279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 189 - 365
Target Start/End: Complemental strand, 44742698 - 44742521
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaag |
287 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||| |||| ||||| |||| | |||||||| || |||||| ||| ||| |||||||||||||| |
|
|
| T |
44742698 |
agggggaaccttggtgcaac-ggtaaagttgttgtcgcgtgattgtaaggtcatgagttcaagttctggaaacaatctcctgtgtaaaaaacagggtaag |
44742600 |
T |
 |
| Q |
288 |
gctgcgtacaatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||| || |||||||||| || |||||||||| ||||| |
|
|
| T |
44742599 |
gctgcgtacaatacaccaaaatggtgggaccccttcttggaccctacggatgcgggagcattagtgcaccggggtgccc |
44742521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 243 - 363
Target Start/End: Original strand, 5689640 - 5689761
Alignment:
| Q |
243 |
gggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgg |
341 |
Q |
| |
|
||||||||||| | ||| |||||||||| ||||| |||||||||||||||||||||||||| |||||||| ||||||| ||| ||| |||||||| || |
|
|
| T |
5689640 |
gggttcaagtcttgtaaatagcctcttgtgtaaaaagcagggtaaggctgcgtacaatacaccaaatggtggaaccccttcccgaaccatgcgtatgtgg |
5689739 |
T |
 |
| Q |
342 |
gagctttggtgcaccgggttgc |
363 |
Q |
| |
|
||||||| ||||||||| |||| |
|
|
| T |
5689740 |
gagctttagtgcaccggtttgc |
5689761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 275 - 366
Target Start/End: Original strand, 19729382 - 19729473
Alignment:
| Q |
275 |
aaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||| ||| |||||||| | |||||| || ||||||| |
|
|
| T |
19729382 |
aaaacagggtaaggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgccct |
19729473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 220 - 366
Target Start/End: Complemental strand, 23000365 - 23000230
Alignment:
| Q |
220 |
ttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggacccc |
319 |
Q |
| |
|
|||||||||||||| || ||||||||| ||||||| ||||||||||||||| ||||||| ||||||| | | ||||||||||| |||||||||||||| |
|
|
| T |
23000365 |
ttgtcatgtgactgaaaggtcacgggt--aagtcctggaaacagcctcttgtgtaaaaacacggtaaggttccatacaatacaccaaatggtgggacccc |
23000268 |
T |
 |
| Q |
320 |
ttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| |||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
23000267 |
ttcccgg---------atgcgggagctttagtgcaccgggttgccct |
23000230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 197 - 354
Target Start/End: Complemental strand, 42083870 - 42083712
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||| ||||||||| ||||||| || |||||||||||||||||| |||||||||| |||| ||||| ||| ||||||||||| |
|
|
| T |
42083870 |
ccttggcgcaac-ggtaaaattgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatggggcaaggctgcgta |
42083772 |
T |
 |
| Q |
296 |
caatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
|| || ||| |||||||||||||||| ||| |||||| ||| | ||||||||| ||||| |
|
|
| T |
42083771 |
cagtataccaaaatggtgggaccccttcccgaaccctgtgtacgtgggagctttagtgca |
42083712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 189 - 300
Target Start/End: Original strand, 11748254 - 11748366
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaag |
287 |
Q |
| |
|
||||||||| |||| ||||||||| || ||||||||||||||||| || |||||||||||||||| | ||||||||||||| | ||||| ||||||||| |
|
|
| T |
11748254 |
aggggtaactttggtgcaactggtgaaattgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttttgtaaaaagcagggtaag |
11748353 |
T |
 |
| Q |
288 |
gctgcgtacaata |
300 |
Q |
| |
|
| |||||||||| |
|
|
| T |
11748354 |
acagcgtacaata |
11748366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 294 - 366
Target Start/End: Original strand, 26102578 - 26102650
Alignment:
| Q |
294 |
tacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
26102578 |
tacaatacaccaaatggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccct |
26102650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 213 - 331
Target Start/End: Original strand, 35105902 - 35106022
Alignment:
| Q |
213 |
aaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacacc-gaatgg |
310 |
Q |
| |
|
||||||||||||| ||| ||| || |||||||||||||||||| |||||| |||||||| |||| | || |||||||||||||||||||||| |||||| |
|
|
| T |
35105902 |
aaagttgttgtcacgtggctgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaagagagtgtaaggctgcgtacaatacaccagaatgg |
35106001 |
T |
 |
| Q |
311 |
tgggaccccttgccggaccct |
331 |
Q |
| |
|
||||||| ||| | ||||||| |
|
|
| T |
35106002 |
tgggacctcttcctggaccct |
35106022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 274 - 362
Target Start/End: Original strand, 16225060 - 16225150
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
362 |
Q |
| |
|
|||||||||||||| |||||||||||||||| | ||||||||| ||||| |||||||| || |||||||||||||| ||||||||||||| |
|
|
| T |
16225060 |
aaaaacagggtaagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
16225150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 280 - 361
Target Start/End: Original strand, 26457776 - 26457855
Alignment:
| Q |
280 |
agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggtt |
361 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||| || |||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
26457776 |
agggtaaggctgcgtacaatacaccaattggtgggacccct--cctgaccttgcgtatgagggagctttagtgcaccgggtt |
26457855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 197 - 347
Target Start/End: Complemental strand, 14018140 - 14017989
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| ||||| |||||||||| |||| || || |||| ||||||||||| | ||||||| ||||||| ||||||||||| || ||||||| |
|
|
| T |
14018140 |
ccttggcgcaac-ggtaatgttgttgtcacgtgattgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaaaacagggtgagactgcgta |
14018042 |
T |
 |
| Q |
296 |
caatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctt |
347 |
Q |
| |
|
|||||||| || |||||||||| ||| | ||||||||| |||||| ||||| |
|
|
| T |
14018041 |
caatacactaaattggtgggaccacttcctggaccctgcagatgcggtagctt |
14017989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 245 - 365
Target Start/End: Complemental strand, 17251001 - 17250879
Alignment:
| Q |
245 |
gttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgg |
341 |
Q |
| |
|
||||||||||| ||| ||||||||||| ||||| |||| |||||| |||||||||||||| | |||||||||||| || ||| |||||||||||| | |
|
|
| T |
17251001 |
gttcaagtcctggaagcagcctcttgtgtaaaaaacaggttaaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaag |
17250902 |
T |
 |
| Q |
342 |
gagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
||||||| ||||| |||||||||| |
|
|
| T |
17250901 |
gagctttagtgca-cgggttgccc |
17250879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 210 - 347
Target Start/End: Complemental strand, 11001109 - 11000970
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcct-ct-tgtagaaaaacagggtaaggctgcgtacaatacaccgaa |
307 |
Q |
| |
|
||||||||||||||||||||| || || ||| ||||||||| | || ||||| ||| || |||| ||||||| | |||||||| |||||||||||| || |
|
|
| T |
11001109 |
ggtaaagttgttgtcatgtgattgaaaggtcgcgggttcaaattctgaaaacaacctactgtgtaaaaaaacaagataaggctgtgtacaatacaccaaa |
11001010 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctt |
347 |
Q |
| |
|
||||||||||||| ||| |||||| ||||| ||||||| |
|
|
| T |
11001009 |
tggtgggacccctacccgaaccctgtttatgcaggagctt |
11000970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 308 - 362
Target Start/End: Original strand, 27507985 - 27508039
Alignment:
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
362 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttg |
27508039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 187 - 231
Target Start/End: Complemental strand, 23286475 - 23286431
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgac |
231 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
23286475 |
tgaggggtaaccttgtcgcaactggtaaagttgttgtcatgtgac |
23286431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 306 - 366
Target Start/End: Complemental strand, 35107373 - 35107313
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||| ||| |||||||| |||||| ||||||||||||||||| |
|
|
| T |
35107373 |
aatggtgggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgccct |
35107313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 40605087 - 40604908
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| || | | | ||||||||||| | |||||| || |||| ||||| || || |
|
|
| T |
40605087 |
tgaggggtaactttggcgcaactggtaaagttgttgtcatgtgattggatgattatgggttcaagtcatggaaacaatcttttgtgtaaaaaattggata |
40604988 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| |||||||||||||| |||| | ||| ||||| | ||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
40604987 |
aggttgcgtacaatacactaaatgat-ggatcccttccgaaaccctacgtatgcgggagctttagtgcaccgaattgccct |
40604908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 323 - 366
Target Start/End: Complemental strand, 27468137 - 27468094
Alignment:
| Q |
323 |
ccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27468137 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
27468094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 260 - 318
Target Start/End: Complemental strand, 23286432 - 23286375
Alignment:
| Q |
260 |
acagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccc |
318 |
Q |
| |
|
|||||||||||| | |||||||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
23286432 |
acagcctcttgt-gtaaaacagggtaaagctgcgtacaatacaccaaatggtgggaccc |
23286375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 197 - 271
Target Start/End: Complemental strand, 30962944 - 30962871
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
|||||||||||| || |||||||||||||||||| || || |||||| |||||||||| ||||||||||||||| |
|
|
| T |
30962944 |
ccttggcgcaac-ggaaaagttgttgtcatgtgattgaaaggtcacgacttcaagtcctggaaacagcctcttgt |
30962871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 306 - 362
Target Start/End: Original strand, 16013529 - 16013585
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
362 |
Q |
| |
|
||||||| |||||||| || |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
16013529 |
aatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttg |
16013585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 307 - 366
Target Start/End: Complemental strand, 36486627 - 36486568
Alignment:
| Q |
307 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| ||| ||||||| ||||||||| |||||||| |||| |||||||||||| |
|
|
| T |
36486627 |
atggtgggacctcttcccggaccttgcgtatgcaggagctttagtgccccgggttgccct |
36486568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 312 - 366
Target Start/End: Original strand, 40444845 - 40444899
Alignment:
| Q |
312 |
gggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| |||||||| | |||||| |
|
|
| T |
40444845 |
gggaccccttgccggaccctgcgtatgttggagctttagtgcaccgagctgccct |
40444899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 274 - 321
Target Start/End: Original strand, 43942365 - 43942414
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacacc--gaatggtgggacccctt |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43942365 |
aaaaacagggtaaggctgcgtacaatacaccaaaaatggtgggacccctt |
43942414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 188 - 225
Target Start/End: Original strand, 42840863 - 42840900
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtca |
225 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42840863 |
gaggggtaaccttggcgcaactagtaaagttgttgtca |
42840900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 313 - 364
Target Start/End: Original strand, 18595918 - 18595969
Alignment:
| Q |
313 |
ggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| ||| ||||| ||||||||| |
|
|
| T |
18595918 |
ggaccccttcccggaccctgtgtatgcgggagttttagtgcatcgggttgcc |
18595969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 189 - 263
Target Start/End: Original strand, 27634983 - 27635058
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtc-atgtgactgtaacgtcacgggttcaagtcctcgaaacag |
263 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||| | ||||||||| || |||||||||||||||||| ||||||| |
|
|
| T |
27634983 |
aggggtagccttggcggaaccagtaaagttgttttttatgtgactgaaatgtcacgggttcaagtcctggaaacag |
27635058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 324 - 366
Target Start/End: Complemental strand, 30962815 - 30962773
Alignment:
| Q |
324 |
cggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||| ||| ||| ||||||||||||| |
|
|
| T |
30962815 |
cggaccctgcgtatgcgggagatttagtgaaccgggttgccct |
30962773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 198 - 226
Target Start/End: Original strand, 5688801 - 5688829
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5688801 |
cttggcgcaactggtaaagttgttgtcat |
5688829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 136; Significance: 8e-71; HSPs: 74)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 38879534 - 38879716
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgta-gaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
38879534 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggta |
38879633 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38879634 |
aggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
38879716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 41014272 - 41014451
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
41014272 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaa |
41014371 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | |||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
41014372 |
ggctgcgtacaatacaccaaatggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccct |
41014451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 24448844 - 24449023
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||| |||| ||||| ||||||| |
|
|
| T |
24448844 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagccttttgtgtaaaaaatagggtaa |
24448943 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
24448944 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccct |
24449023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 8170163 - 8169986
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| | || |||||||||||||||||| |||||||||| |||| | ||||||||||||| |
|
|
| T |
8170163 |
gagggctaaccttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagccttttgt-gtaaaacagggtaag |
8170065 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||| || ||||||||||||||||| |
|
|
| T |
8170064 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgccct |
8169986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 191 - 366
Target Start/End: Original strand, 43334159 - 43334337
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctc--ttgtagaaaaacagggtaagg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||| |||| ||||||||||||||| |
|
|
| T |
43334159 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtaaaaaaacagggtaagg |
43334258 |
T |
 |
| Q |
289 |
ctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
43334259 |
ctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcg-atgcgggagctttagtgcaccgggttgccct |
43334337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 35710267 - 35710444
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||| ||||||||||||||| | |||| |||||||| |
|
|
| T |
35710267 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaatagggtaag |
35710365 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||| ||||| | ||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
35710366 |
gctgcgttcaatacaccaaatggtgggaccccttcccggaacatgcatatgcgggagctctagtgcaccgggttgccct |
35710444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 191 - 366
Target Start/End: Complemental strand, 4619284 - 4619106
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
4619284 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaacagggtaaggc |
4619185 |
T |
 |
| Q |
290 |
tgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||| || |||||| ||||||| ||||||||||||||||| |
|
|
| T |
4619184 |
tgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccct |
4619106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 221 - 366
Target Start/End: Original strand, 32703411 - 32703555
Alignment:
| Q |
221 |
tgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggacccct |
320 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
32703411 |
tgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatggtgggacccct |
32703509 |
T |
 |
| Q |
321 |
tgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
32703510 |
tcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
32703555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 1565385 - 1565564
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||| |||||| |||||| ||| ||||||| || |
|
|
| T |
1565385 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgagtaaaaaaacatatta |
1565484 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| |||| ||||| |||||||||| ||||||||||| |||| |||||| || ||||||||||||||||| |
|
|
| T |
1565485 |
aggctgcgtacaatgcaccaaatggcgggaccccttcccggaccctgcatatgtgggagc-ttagtgcaccgggttgccct |
1565564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 189 - 354
Target Start/End: Original strand, 2838733 - 2838899
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacg-tcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| | ||||| | ||||||| |||||||| |||||| |||||||||||||| |
|
|
| T |
2838733 |
aggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaaggtcacgaggtcaagtctcagaaacagcatcttgtgtaaaaacagggtaag |
2838832 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| |||||||||||||||||||||| | |||||| |
|
|
| T |
2838833 |
gctgcgtacaatacaccaaatggtgggatcccttctcggaccctgcgtatgcgggagcatcggtgca |
2838899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 191 - 348
Target Start/End: Original strand, 27328709 - 27328869
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggc |
289 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||||||||| || ||||| |||||||||||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
27328709 |
gggtaaccttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagtctcttgtgtaaaaaacagggtaaggc |
27328808 |
T |
 |
| Q |
290 |
tgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
27328809 |
tgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagcttt |
27328869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 186 - 298
Target Start/End: Complemental strand, 37024737 - 37024626
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
37024737 |
ttgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagggta |
37024639 |
T |
 |
| Q |
286 |
aggctgcgtacaa |
298 |
Q |
| |
|
||||||||||||| |
|
|
| T |
37024638 |
aggctgcgtacaa |
37024626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 186 - 348
Target Start/End: Original strand, 22600406 - 22600569
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggt |
284 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||| ||||||||||| || || ||||||||||||||| |||||| | |||| |||| ||||||| |
|
|
| T |
22600406 |
ttgaggggtaaccttgacgtaactggtaaagttgttatcatgtgactggaaggttacgggttcaagtcctggaaacaatattttgtgtaaaacacagggt |
22600505 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||||| |||||||||||| |||||||||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
22600506 |
aaggctgtgtacaatacaccaaatggtgggatcccttcccggatcctgcgtatgcgggagcttt |
22600569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 197 - 355
Target Start/End: Complemental strand, 19143113 - 19142956
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||| || | ||| |||||||||||| |||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
19143113 |
ccttggcgcaa-tggtaaaattgttgtcacgtgactaaaatgccacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggctgcgtac |
19143015 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
| |||||| |||||||||||||||| ||||||| |||||||||||||| ||| |||||| |
|
|
| T |
19143014 |
agtacaccaaatggtgggaccccttcccggaccatgcgtatgcgggagatttagtgcac |
19142956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 16 - 143
Target Start/End: Complemental strand, 39225980 - 39225847
Alignment:
| Q |
16 |
atattgttgaactctgaatttgaggctcatgttgctgattttggacttgctaagttct---tgcaagata---atgggaattcagaatgcatgtcttcta |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||| |||||||||||||| | |
|
|
| T |
39225980 |
atattgttgaactctgagtttgaggctcatgttgctgattttggacttgctaagttcttgctgcaagatactggtgggacttctgaatgcatgtcttcca |
39225881 |
T |
 |
| Q |
110 |
ttgctggttcttatggatatattgctccaggtac |
143 |
Q |
| |
|
||| |||||||||||| || |||||||||||||| |
|
|
| T |
39225880 |
ttgttggttcttatggctacattgctccaggtac |
39225847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 249 - 365
Target Start/End: Original strand, 7368413 - 7368528
Alignment:
| Q |
249 |
aagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||||| ||||||||||||||| | |||||||||||||||||||||||||||||| | |||||||||||||| ||||||||||| |||| ||||||| | |
|
|
| T |
7368413 |
aagtcctggaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaattggtgggaccccttcccggaccctgcatatgtgggagctct |
7368511 |
T |
 |
| Q |
349 |
ggtgcaccgggttgccc |
365 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7368512 |
agtgcaccgggttgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 238 - 359
Target Start/End: Original strand, 43574610 - 43574732
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgtaga-aaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgta |
336 |
Q |
| |
|
|||||| ||||||||||| |||||| ||||||| | |||||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||| |
|
|
| T |
43574610 |
gtcacgtgttcaagtcctggaaacaatctcttgtgtagaaaacagggtaaggctgcgtacaatataccaaatggtgggaccccttcccggaccctgcgta |
43574709 |
T |
 |
| Q |
337 |
tgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
|||||||||||| | |||||||| |
|
|
| T |
43574710 |
tgcgggagctttagagcaccggg |
43574732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 197 - 359
Target Start/End: Complemental strand, 209098 - 208936
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||| || ||||| ||||||||||| | |||| |||||||| ||||||||||||||||||| | | |
|
|
| T |
209098 |
ccttggcgcagc-ggtaaagttgttgtcatgtgactaaaaggtcacaagttcaagtcctggcaacaacctcttgtgtaaaaacagggtaaggctgcattc |
209000 |
T |
 |
| Q |
297 |
aatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
|||||||| |||||||||||||||| | |||||||| |||||| ||||||| |||||||||| |
|
|
| T |
208999 |
aatacaccaaaatggtgggaccccttcctggaccctgggtatgcaagagctttagtgcaccggg |
208936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 243 - 366
Target Start/End: Complemental strand, 13801895 - 13801769
Alignment:
| Q |
243 |
gggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgc |
339 |
Q |
| |
|
||||||||||||| ||| ||||||||||| ||||| |||||||||||||||||||||||||| | ||||||||||||||| |||||||| || ||||| |
|
|
| T |
13801895 |
gggttcaagtcctggaagcagcctcttgtgtaaaaaacagggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
13801796 |
T |
 |
| Q |
340 |
gggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| ||||||| ||||||||||||||||| |
|
|
| T |
13801795 |
gagagctttagtgcaccgggttgccct |
13801769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 191 - 366
Target Start/End: Complemental strand, 22861844 - 22861671
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggct |
290 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||| || ||||||| |||||||||| ||| ||| ||||||| | |||||| ||||| || |
|
|
| T |
22861844 |
gggtaaccttggcacaactgataaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaagcagtctcttgt-gtaaaaca-agtaagact |
22861747 |
T |
 |
| Q |
291 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| |||||||| | |||||||||||||||| || ||||||| |||||||||||| | |||||||| ||||||| |
|
|
| T |
22861746 |
gctcacaatacatcaaatggtgggaccccttctcgaaccctgcatatgcgggagctctagtgcaccgaattgccct |
22861671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 194 - 364
Target Start/End: Original strand, 30006285 - 30006456
Alignment:
| Q |
194 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaa-aacagggtaaggctgc |
292 |
Q |
| |
|
|||| |||||||||||| |||| ||||||||||||||||| || |||| | ||||||||| ||||| |||||| || ||| ||||||||||||||| |
|
|
| T |
30006285 |
taacattggcgcaactgataaatttgttgtcatgtgactgaaaggtcatagattcaagtccggaaaacaacctcttatataaacaacagggtaaggctgt |
30006384 |
T |
 |
| Q |
293 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||| ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
30006385 |
gtacattacactaaatggtgggaccccttcccggggcctatgtatgcgggagctttagtgcaccgggttgcc |
30006456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 258 - 356
Target Start/End: Complemental strand, 7097870 - 7097772
Alignment:
| Q |
258 |
aaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||||||||||||| ||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
7097870 |
aaacagcctcttgtgtaaaaacagggtaaggttgcgtacaatacaccaaatggtgagaccccttcccgaaccctgcgtatgcgggagctttagtgcacc |
7097772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 199 - 366
Target Start/End: Complemental strand, 12006500 - 12006330
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacggg-ttcaagtcctcgaaacagcctctt--gtagaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||| || |||||||| |||||||| | |||||| |||||| ||| ||||| ||||||||||| | || |
|
|
| T |
12006500 |
ttggcgcaactgctcaagttgttgtcatgtgactgaaaggtcacggggttcaagtc-tggaaacaacctcttatgta-aaaaatagggtaaggctccata |
12006403 |
T |
 |
| Q |
296 |
caatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| | ||||||||||||||| || |||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
12006402 |
caatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcaccgtgttgccct |
12006330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 218 - 358
Target Start/End: Original strand, 1850624 - 1850764
Alignment:
| Q |
218 |
tgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggacc |
317 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||| |||| | |||||||| |||||||| ||||| ||||||||||||| | |||||||||||| |
|
|
| T |
1850624 |
tgttgtcatgtgactgaaaggtcacgggttcaagtcccggaaataacctcttgtgtaaaaacagaataagggtgcgtacaatacatcaaatggtgggacc |
1850723 |
T |
 |
| Q |
318 |
ccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||| | |||||||||| |||||| |||||| ||||||||| |
|
|
| T |
1850724 |
acttcctggaccctgcggatgcggaagctttagtgcaccgg |
1850764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 274 - 366
Target Start/End: Complemental strand, 16880741 - 16880649
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||| ||| ||||||| |||||||||||||||||| |||||||||||| |||| |
|
|
| T |
16880741 |
aaaaacagggtaaggctgcgtacaatacaccaaatggtgtgaccacttcccggaccatgcgtatgcgggagctttagtgcaccgggtttccct |
16880649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 186 - 293
Target Start/End: Original strand, 23974733 - 23974840
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggt |
284 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||| |||||| |||||||| ||||| ||||| |
|
|
| T |
23974733 |
ttgaggggtaaccttggcgcaac-ggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaagagggt |
23974831 |
T |
 |
| Q |
285 |
aaggctgcg |
293 |
Q |
| |
|
||||||||| |
|
|
| T |
23974832 |
aaggctgcg |
23974840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 279 - 366
Target Start/End: Complemental strand, 34154903 - 34154816
Alignment:
| Q |
279 |
cagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| ||||||||||| ||||||| |||| | ||||||||||||||||| |
|
|
| T |
34154903 |
cagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgccct |
34154816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 293 - 366
Target Start/End: Original strand, 16957374 - 16957447
Alignment:
| Q |
293 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
16957374 |
gtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
16957447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 185 - 304
Target Start/End: Original strand, 22187236 - 22187356
Alignment:
| Q |
185 |
attgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacaggg |
283 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||| |||||| || ||||| |||| ||||||| ||||||||||||||| ||||||| | |
|
|
| T |
22187236 |
attgaggggtaactttggcgcaactagtaaagttgttgtcatttgactgaaaggtcaccggtttaagtcctggaaacagcctcttgtgtaaaaaacatga |
22187335 |
T |
 |
| Q |
284 |
taaggctgcgtacaatacacc |
304 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
22187336 |
taagactgcgtacaatacacc |
22187356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 197 - 359
Target Start/End: Original strand, 39301087 - 39301249
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtaga-aaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||| || |||||||||||||||| | | |||| |||||||| | |||||||||||||| |||||| |
|
|
| T |
39301087 |
ccttggcgcaac-ggtaaagttgttgtcatgttactgaaaggtcacgggttcaagtcttgggaacaacctcttgtgtataaaacagggtaaggatgcgta |
39301185 |
T |
 |
| Q |
296 |
caatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||| |||| || ||||||||||||| ||||||||| |||||| ||||| ||| |||||||||| |
|
|
| T |
39301186 |
taatgcaccaaaaaggtgggaccccttcccggaccctccgtatgtgggag-tttagtgcaccggg |
39301249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 217 - 366
Target Start/End: Original strand, 1405170 - 1405320
Alignment:
| Q |
217 |
ttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgtacaatacaccgaatggtggga |
315 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |||||| |||||| || ||||| || ||||| ||||||||||||||| |||||||||| |
|
|
| T |
1405170 |
ttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaacaacctcttatataaaaaatagagtaagtttgcgtacaatacaccaaatggtggga |
1405269 |
T |
 |
| Q |
316 |
ccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| || | | ||||||| |||||||||||| | || |||||| ||||||| |
|
|
| T |
1405270 |
ccctttcctgaaccctgcatatgcgggagctctagtacaccggattgccct |
1405320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 210 - 366
Target Start/End: Complemental strand, 28516593 - 28516435
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaataca-ccgaa |
307 |
Q |
| |
|
|||||||||||||||| ||| ||| || |||||||||||||||| | |||||| |||||||| ||||||||| || |||||||||||||||| | || |
|
|
| T |
28516593 |
ggtaaagttgttgtcaggtggctgaaaggtcacgggttcaagtcttggaaacatcctcttgtgtaaaaaacaggctagggctgcgtacaatacatcaaaa |
28516494 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| || || ||||||||| |||| |||||||| ||| ||| ||||||||| |
|
|
| T |
28516493 |
tggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgccct |
28516435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 193 - 302
Target Start/End: Original strand, 31299591 - 31299700
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgc |
292 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| | ||||| ||||||||||| |||||||||||||||| ||||||| |||| |||| |
|
|
| T |
31299591 |
gtaaccttggtgcaactggtaaagttgttgtcatgtgacttacaggtcactagttcaagtcctagaaacagcctcttgtattaaaacagtgtaaaactgc |
31299690 |
T |
 |
| Q |
293 |
gtacaataca |
302 |
Q |
| |
|
|||||||||| |
|
|
| T |
31299691 |
gtacaataca |
31299700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 211 - 366
Target Start/End: Original strand, 3771318 - 3771472
Alignment:
| Q |
211 |
gtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatgg |
310 |
Q |
| |
|
|||| |||||| ||| ||||||| || ||||| |||| ||||| | |||||| || | ||| |||||||||||||||||| | |||||||||| | ||| |
|
|
| T |
3771318 |
gtaatgttgttctcacgtgactgaaaggtcacaggtttaagtcatgtaaacagtctgt-gtaaaaaaacagggtaaggctgtgaacaatacaccaattgg |
3771416 |
T |
 |
| Q |
311 |
tgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| |||||| ||| ||||| ||||||||| |||||||||| |||||| |
|
|
| T |
3771417 |
tgggaccccttcccggactctgtgtatgtgggagctttagtgcaccgggctgccct |
3771472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 43 - 142
Target Start/End: Original strand, 4979313 - 4979412
Alignment:
| Q |
43 |
catgttgctgattttggacttgctaagttcttgcaagataatgggaattcagaatgcatgtcttctattgctggttcttatggatatattgctccaggta |
142 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||| | || |||||||||||| ||||||||||||| |||||||| || |||||||||| |
|
|
| T |
4979313 |
catgttgctgattttggacttgccaagttcttgcaagattctggaacatctgaatgcatgtctgctattgctggttcatatggatacatagctccaggta |
4979412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 257 - 366
Target Start/End: Original strand, 29334418 - 29334529
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||||||||||||||||| |||||||||||||| || |||||||||||||||| |||| |||| |||| |
|
|
| T |
29334418 |
gaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccagaatggtgggacccattcccggaccctgcgtatgtgggatctttaatgca |
29334517 |
T |
 |
| Q |
355 |
ccgggttgccct |
366 |
Q |
| |
|
||||| |||||| |
|
|
| T |
29334518 |
ccgggctgccct |
29334529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 252 - 366
Target Start/End: Complemental strand, 12575779 - 12575662
Alignment:
| Q |
252 |
tcctcgaaacagcctcttg--tagaaaaacagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||| |||||||||||||| || | ||||||| ||| | ||||||||||||||| || |||||||||||||| | ||||||||||||||| |||||||| |
|
|
| T |
12575779 |
tcctggaaacagcctcttgcgtaaataaacaggctaaagttgcgtacaatacaccaaaatggtgggaccccttcctggaccctgcgtatgcaggagcttt |
12575680 |
T |
 |
| Q |
349 |
ggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| |||||| |
|
|
| T |
12575679 |
ggtgcaccgggctgccct |
12575662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 257 - 366
Target Start/End: Original strand, 20135627 - 20135739
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgc |
353 |
Q |
| |
|
||||||||||||||| ||||| || ||||||||||||||||||||||| | ||||||||||||||| |||||||| || ||||| ||||||| |||| |
|
|
| T |
20135627 |
gaaacagcctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgc |
20135726 |
T |
 |
| Q |
354 |
accgggttgccct |
366 |
Q |
| |
|
||||||||||||| |
|
|
| T |
20135727 |
accgggttgccct |
20135739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 219 - 320
Target Start/End: Complemental strand, 22908014 - 22907913
Alignment:
| Q |
219 |
gttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccc |
318 |
Q |
| |
|
||||| ||||||||| || |||| |||||||||||| ||||||||||||||| |||||||| |||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
22908014 |
gttgttatgtgactgaaaggtcaagggttcaagtccaagaaacagcctcttgtgtaaaaacagagtaaggttgcatacaatacaccaaatggtgggaccc |
22907915 |
T |
 |
| Q |
319 |
ct |
320 |
Q |
| |
|
|| |
|
|
| T |
22907914 |
ct |
22907913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 257 - 366
Target Start/End: Complemental strand, 5873433 - 5873324
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||| ||||| |||||| | ||||||||| ||| |||||| ||||||||||||||||||| ||||| | |
|
|
| T |
5873433 |
gaaacagcctcttgtgtaaaaatagggtaaggctaagtacactacaccaattggtgggactcctccccggacactgcgtatgcgggagctttagtgcatc |
5873334 |
T |
 |
| Q |
357 |
gggttgccct |
366 |
Q |
| |
|
||| |||||| |
|
|
| T |
5873333 |
gggatgccct |
5873324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 306 - 366
Target Start/End: Original strand, 25622533 - 25622593
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
25622533 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccct |
25622593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 306 - 365
Target Start/End: Complemental strand, 21784394 - 21784335
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
21784394 |
aatggtgggacccctttccggaccctgcgtatgcgggaggtttagtgcaccgagttgccc |
21784335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 289 - 359
Target Start/End: Original strand, 13774921 - 13774991
Alignment:
| Q |
289 |
ctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||||| |||||||||| ||||| ||| ||||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
13774921 |
ctgcgcacaatacaccaaatggcaggatccctttccggaccctgcgtatgcgggagctttagtgcaccggg |
13774991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 212 - 349
Target Start/End: Complemental strand, 24323862 - 24323724
Alignment:
| Q |
212 |
taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaatgg |
310 |
Q |
| |
|
|||||||||| || |||||||| || |||| |||||||| || |||||| |||||||| |||| |||||||||| |||||| ||||| || ||| | |
|
|
| T |
24323862 |
taaagttgttatcgtgtgactgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatag |
24323763 |
T |
 |
| Q |
311 |
tgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
24323762 |
tgggaccccttcccagaccctgtatatgcgggagctttg |
24323724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 212 - 349
Target Start/End: Complemental strand, 24360486 - 24360348
Alignment:
| Q |
212 |
taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaatgg |
310 |
Q |
| |
|
|||||||||| || |||||||| || |||| |||||||| || |||||| |||||||| |||| |||||||||| |||||| ||||| || ||| | |
|
|
| T |
24360486 |
taaagttgttatcgtgtgactgaaatgtcaaatgttcaagttctggaaacaacctcttgtgtaaaagacagggtaagcttgcgtataatactccaaatag |
24360387 |
T |
 |
| Q |
311 |
tgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
||||||||||| || ||||||| ||||||||||||||| |
|
|
| T |
24360386 |
tgggaccccttcccagaccctgtatatgcgggagctttg |
24360348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 210 - 359
Target Start/End: Complemental strand, 24903855 - 24903705
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||| ||||||||| ||||||| || |||| ||| |||||||| ||||||||| |||| ||||| |||||||| || ||||||| |||| | | |
|
|
| T |
24903855 |
ggtaaatttgttgtcacgtgactgaaaagtcatgggcacaagtcctgaaaacagccttttgtgtaaaaaatagggtaagattgtgtacaatccaccaatt |
24903756 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
|||| |||||||| |||||| |||| || |||||| ||||||||||||||| |
|
|
| T |
24903755 |
ggtgagaccccttcccggacactgcatacgcgggaactttggtgcaccggg |
24903705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 309 - 366
Target Start/End: Complemental strand, 16028683 - 16028626
Alignment:
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
16028626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 214 - 346
Target Start/End: Complemental strand, 34074717 - 34074584
Alignment:
| Q |
214 |
aagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaatacaccgaatggtg |
312 |
Q |
| |
|
|||||||||||| |||||| || ||||| ||||||||||| ||||||||||||||| ||||||| |||||| ||||| ||||||||| ||||| |
|
|
| T |
34074717 |
aagttgttgtcacatgactgaaaggtcacaagttcaagtcctagaaacagcctcttgtgtaaaaaacacagtaaggttgcgttcaatacaccaaatggca |
34074618 |
T |
 |
| Q |
313 |
ggaccccttgccggaccctgcgtatgcgggagct |
346 |
Q |
| |
|
|| |||||| || |||||||||||| ||||||| |
|
|
| T |
34074617 |
gggccccttcccaaaccctgcgtatgggggagct |
34074584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 188 - 232
Target Start/End: Original strand, 19438703 - 19438747
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgact |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19438703 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatatgact |
19438747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 308 - 364
Target Start/End: Original strand, 39801591 - 39801647
Alignment:
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||||||||||| || |||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
39801591 |
tggtgggaccccttcccagaccctacgtatgcgggagctttagtgcaccgggttgcc |
39801647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 197 - 303
Target Start/End: Complemental strand, 10634317 - 10634211
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| ||| |||||||||||| ||||||| || |||| ||||||||||||| |||||| |||| ||| ||||| |||||||||||| ||| |
|
|
| T |
10634317 |
ccttggcgcaac-ggtgaagttgttgtcaagtgactgaaaggtcatgggttcaagtcctagaaacaacctcgtgtgcaaaaatcagggtaaggctcggta |
10634219 |
T |
 |
| Q |
296 |
caatacac |
303 |
Q |
| |
|
||||||| |
|
|
| T |
10634218 |
aaatacac |
10634211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 238 - 340
Target Start/End: Original strand, 41425952 - 41426055
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgta |
336 |
Q |
| |
|
||||||||||||||| || |||||| | | |||| ||||||||||||||||||| ||||||||||| | |||||||||||||| || ||| ||||| | |
|
|
| T |
41425952 |
gtcacgggttcaagttctggaaacaacttattgtgtaaaaaacagggtaaggctgcatacaatacaccaattggtgggaccccttcccagactctgcgga |
41426051 |
T |
 |
| Q |
337 |
tgcg |
340 |
Q |
| |
|
|||| |
|
|
| T |
41426052 |
tgcg |
41426055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 306 - 348
Target Start/End: Complemental strand, 10306536 - 10306494
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10306536 |
aatggtgggaccccttcccggaccctgcgtatgcgggagcttt |
10306494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 284 - 356
Target Start/End: Complemental strand, 12477205 - 12477132
Alignment:
| Q |
284 |
taaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||| ||||| |||||||||| ||||||| ||||||| |
|
|
| T |
12477205 |
taaggctgcgtacaatacaccaaaatggtgggaccccttcccggattctgcgtatgcaagagctttagtgcacc |
12477132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 309 - 366
Target Start/End: Complemental strand, 30877623 - 30877566
Alignment:
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| ||||||||||| |||| ||||||| | ||||||||||||||||| |
|
|
| T |
30877623 |
ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccct |
30877566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 317 - 366
Target Start/End: Original strand, 32354211 - 32354260
Alignment:
| Q |
317 |
cccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
32354211 |
cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccct |
32354260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 197 - 253
Target Start/End: Complemental strand, 39079937 - 39079882
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtc |
253 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| | || |||||||||||||||| |
|
|
| T |
39079937 |
ccttggcgcaac-ggtaaagttgttgtcatgtgacagaaaggtcacgggttcaagtc |
39079882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 311 - 366
Target Start/End: Complemental strand, 29184118 - 29184063
Alignment:
| Q |
311 |
tgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| ||||| | |||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29184118 |
tgggactccttgtcagaccatgcgtatgcgggagctttagtgcaccgggttgccct |
29184063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 187 - 226
Target Start/End: Original strand, 41956885 - 41956924
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcat |
226 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41956885 |
tgaggggtaacattggcgcaactggtaaagttgttgtcat |
41956924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 226 - 358
Target Start/End: Complemental strand, 42924977 - 42924840
Alignment:
| Q |
226 |
tgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacacc--gaatggtgggaccccttg |
322 |
Q |
| |
|
|||||||| || |||||| ||||||||||| ||||| | |||||| ||||| |||||||||| ||||||||||||||| |||| ||| | ||||| |
|
|
| T |
42924977 |
tgtgactgaaaggtcacgagttcaagtcctgaaaacaacatcttgtgtaaaaaacagggtaaggttgcgtacaatacaccaaaaatgatggaatcccttc |
42924878 |
T |
 |
| Q |
323 |
ccgg--accctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
|| | ||||||||||||||| |||||| ||||||||| |
|
|
| T |
42924877 |
ccagacaccctgcgtatgcggaagctttagtgcaccgg |
42924840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 17419879 - 17419944
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagc |
264 |
Q |
| |
|
|||||| |||||||||| ||||||| ||||||||| || || ||| ||||||||||| |||||||| |
|
|
| T |
17419879 |
ttggcgtaactggtaaaattgttgtaatgtgactgaaaggttacgagttcaagtcctggaaacagc |
17419944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 283 - 366
Target Start/End: Complemental strand, 11657785 - 11657701
Alignment:
| Q |
283 |
gtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| ||||||||||| || |||||||||||||| ||| ||||||| | |||||| |||| || ||||||| |||||| |
|
|
| T |
11657785 |
gtaaggctgcatacaatacaccaaaatggtgggaccccttcccgaaccctgcacacgcgggaactttagttcaccgggctgccct |
11657701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 346
Target Start/End: Complemental strand, 21542529 - 21542489
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagct |
346 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
21542529 |
aatggtgggaccccttcccggactctgcgtatgcgggagct |
21542489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 275 - 358
Target Start/End: Complemental strand, 9794471 - 9794388
Alignment:
| Q |
275 |
aaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||||||||||||| |||| ||||||||||| ||| |||||| ||||| | ||||| || ||||| | |||||| ||||||||| |
|
|
| T |
9794471 |
aaaacagggtaagactgcatacaatacaccaaatagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccgg |
9794388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 229 - 291
Target Start/End: Original strand, 22025538 - 22025601
Alignment:
| Q |
229 |
gactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctg |
291 |
Q |
| |
|
||||| || |||| ||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
22025538 |
gactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctg |
22025601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 283 - 355
Target Start/End: Complemental strand, 3176839 - 3176770
Alignment:
| Q |
283 |
gtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||||| |||||| ||| |||||| |||||||| |||||| |
|
|
| T |
3176839 |
gtaaggttgcgtacaatacaccaactggtgggacccc---ccggactctgtgtatgccggagctttagtgcac |
3176770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 312 - 366
Target Start/End: Complemental strand, 10943900 - 10943847
Alignment:
| Q |
312 |
gggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||||||| |||||| |
|
|
| T |
10943900 |
gggaccccttcccggaccctgca-atgcgggagctttagtgcaccgggctgccct |
10943847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 274 - 356
Target Start/End: Complemental strand, 31694202 - 31694120
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
||||| ||| ||| ||||| ||||||||||| | || |||||| |||| || |||| |||||||||||||| ||| ||||||| |
|
|
| T |
31694202 |
aaaaataggctaaagctgcatacaatacacctattgatgggactccttcccagaccttgcgtatgcgggagatttagtgcacc |
31694120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 293 - 354
Target Start/End: Original strand, 18426099 - 18426160
Alignment:
| Q |
293 |
gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
|||||||||| ||||||||| |||||||| || || ||||||||||| ||||||| ||||| |
|
|
| T |
18426099 |
gtacaatacatcgaatggtgagaccccttttcgaactctgcgtatgcgagagctttagtgca |
18426160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 326 - 363
Target Start/End: Original strand, 18684366 - 18684403
Alignment:
| Q |
326 |
gaccctgcgtatgcgggagctttggtgcaccgggttgc |
363 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
18684366 |
gaccctgcgtatgcgggagctttagtgcatcgggttgc |
18684403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 209 - 250
Target Start/End: Complemental strand, 31362495 - 31362454
Alignment:
| Q |
209 |
tggtaaagttgttgtcatgtgactgtaacgtcacgggttcaa |
250 |
Q |
| |
|
|||||||||||||||||||||| || || ||||||||||||| |
|
|
| T |
31362495 |
tggtaaagttgttgtcatgtgattggaaggtcacgggttcaa |
31362454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 209 - 300
Target Start/End: Original strand, 18698586 - 18698675
Alignment:
| Q |
209 |
tggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaata |
300 |
Q |
| |
|
||||||| | ||||||| |||| || | ||||||||||||||| || |||||||||||||| ||||||| |||| |||||| ||||||| |
|
|
| T |
18698586 |
tggtaaaatggttgtcacgtgattgaacggtcacgggttcaagtactgaaaacagcctcttgt--aaaaacaaggtacggctgcatacaata |
18698675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 314 - 366
Target Start/End: Original strand, 19093894 - 19093946
Alignment:
| Q |
314 |
gaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| |||||||||||||||| |||||||| |||||||||| |||||| |
|
|
| T |
19093894 |
gacccctacccggaccctgcgtatgttggagctttagtgcaccgggctgccct |
19093946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 293 - 364
Target Start/End: Complemental strand, 39079827 - 39079755
Alignment:
| Q |
293 |
gtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||||||||| || |||||||||||||| ||||||| || |||| |||||| ||| |||||| ||| |||| |
|
|
| T |
39079827 |
gtacaatacaccaaaatggtgggaccccttcccggaccatgtgtatacgggagttttagtgcacagggctgcc |
39079755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 136; Significance: 8e-71; HSPs: 79)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 8455497 - 8455318
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |||| ||||||||| |
|
|
| T |
8455497 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaacacagggtaa |
8455398 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
8455397 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccct |
8455318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 186 - 366
Target Start/End: Original strand, 14530270 - 14530453
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgta-gaaaaacagggt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
14530270 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggt |
14530369 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14530370 |
aaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
14530453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 9671134 - 9671312
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaac-gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||| |||| ||||||||||||||| | |||||||||||| |
|
|
| T |
9671134 |
gaggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactggaaatgtcacgggttcaaatcctggaaacagcctcttgt-gtaaaacagggtaa |
9671232 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9671233 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
9671312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 21779441 - 21779263
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| || |||||||||||||||||| || |||||||||||| | |||||||||||| |
|
|
| T |
21779441 |
tgaggggtaaccttggcgcaactggtgaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggagacagcctcttgt-gtaaaacagggtaa |
21779343 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
21779342 |
ggttgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
21779263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 186 - 366
Target Start/End: Complemental strand, 25079901 - 25079719
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt--agaaaaacaggg |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| | |||||| |||||||| | ||||||| || |
|
|
| T |
25079901 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttagaaacaacctcttgtgtaaaaaaacaagg |
25079802 |
T |
 |
| Q |
284 |
taaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
25079801 |
taaggatgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttgccct |
25079719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 189 - 366
Target Start/End: Original strand, 10543653 - 10543833
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| || |||||||||||||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
10543653 |
aggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacggcctcttgtgtaaaaaacagggtaag |
10543752 |
T |
 |
| Q |
288 |
gctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10543753 |
gctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
10543833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 191 - 366
Target Start/End: Complemental strand, 25249915 - 25249740
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggct |
290 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| | ||||||| ||||||| | ||||||||||||||| |
|
|
| T |
25249915 |
gggtaaccttggcgcaattggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatggaaacagtctcttgtgtacaaacagggtaaggct |
25249816 |
T |
 |
| Q |
291 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||| |||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
25249815 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccct |
25249740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 188 - 358
Target Start/End: Complemental strand, 12024099 - 12023929
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
12024099 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaag |
12024000 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | ||||||||||||||| || |||||| |||||||| |
|
|
| T |
12023999 |
gctgcgtacaatacaccaaatggtgggaccccctcccggaccctgcgtatttggaagctttaatgcaccgg |
12023929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 23397719 - 23397897
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| || |||| ||||||||||||| ||||||||||||||| | |||| ||||||| |
|
|
| T |
23397719 |
tgaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgt-gtaaaatagggtaa |
23397817 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||| |||||||| | |||||||||||| | ||||||||||||||||| |
|
|
| T |
23397818 |
ggctacgtacaatacaccaaatggtgggaccccttctcggaccctacatatgcgggagctctagtgcaccgggttgccct |
23397897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 190 - 366
Target Start/End: Original strand, 11514392 - 11514568
Alignment:
| Q |
190 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaagg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
11514392 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaactcctggaaacagcctcttgtgtaaaaaacaaagtaagg |
11514491 |
T |
 |
| Q |
289 |
ctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||| || ||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
11514492 |
ctgcgtacaatacaccaaatggtggga-cccttcccagaccctgcgtatgcgggagctttagtgcaccggattgccct |
11514568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 189 - 366
Target Start/End: Complemental strand, 24200805 - 24200625
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
24200805 |
aggggtaaccttgatgcaactggtaaagttgttgtcatgtgactgaaaagtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaag |
24200706 |
T |
 |
| Q |
288 |
gctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| |||||||||| ||||| | ||||||| ||||||||||||||||| |
|
|
| T |
24200705 |
gctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccct |
24200625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 187 - 337
Target Start/End: Original strand, 22371010 - 22371158
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||||||||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
22371010 |
tgaggggtaaccttggcccaactggtaaagttgttgtcatgtgactgggaggtcacgggttcaagtcctggaaacagcctcgtgt--aaaaacagggtaa |
22371107 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
337 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||||| |||| |
|
|
| T |
22371108 |
ggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgtgtat |
22371158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 225 - 366
Target Start/End: Original strand, 10546153 - 10546296
Alignment:
| Q |
225 |
atgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa--acagggtaaggctgcgtacaatacaccgaatggtgggaccccttg |
322 |
Q |
| |
|
||||||||| || |||||||||||||||||| |||||| ||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10546153 |
atgtgactgaaaggtcacgggttcaagtcctggaaacatcctcttgtataaaaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttc |
10546252 |
T |
 |
| Q |
323 |
ccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10546253 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
10546296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 190 - 366
Target Start/End: Original strand, 17896215 - 17896393
Alignment:
| Q |
190 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt--agaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| | || ||||||| |||||||||| |||||| |||||||| | ||||| |||||||| |
|
|
| T |
17896215 |
ggggtaaccttgacgcaactggtaaagttgttgtcatgtgaccgaaaggtcacggattcaagtcctagaaacaacctcttgtgtaaaaaaatagggtaag |
17896314 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| ||||||||||||||| ||||||||| ||||| || |||||||| |
|
|
| T |
17896315 |
gctgcgtacaatataccaaatggtgggaccccttctcggaccctgcgtatgtgggagctttagtgcatcgagttgccct |
17896393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 225 - 366
Target Start/End: Original strand, 14444720 - 14444861
Alignment:
| Q |
225 |
atgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgcc |
324 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||| ||||||| |||||||||||||||| || |
|
|
| T |
14444720 |
atgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaaggctgtgtacgatacaccaaatggtgggaccccttccc |
14444819 |
T |
 |
| Q |
325 |
ggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
14444820 |
ggaccctgcgtatgcgggagctttagtgcaccaggttgccct |
14444861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 200 - 366
Target Start/End: Complemental strand, 39914475 - 39914308
Alignment:
| Q |
200 |
tggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggtaaggctgcgtaca |
297 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || |||||||| |||||| || |||||| ||||| |||| ||||||||||||||| || ||||| |
|
|
| T |
39914475 |
tggcgcatctggtaaagttgttgtcatgtgactggaaggtcacgggatcaagtactggaaacaacctcttgtgtaaaaaaacagggtaaggatgtgtaca |
39914376 |
T |
 |
| Q |
298 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
39914375 |
atacaccgaatggtgggacccctt-cctgaccctgcgtatgcgggagctttagtgcatcgggttgccct |
39914308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 205 - 366
Target Start/End: Original strand, 17623535 - 17623697
Alignment:
| Q |
205 |
caactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacac |
303 |
Q |
| |
|
||||||||||||||||||||||| ||||| || ||||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
17623535 |
caactggtaaagttgttgtcatgcgactggaaggtcacgggttcaagtcctcgaaacaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacac |
17623634 |
T |
 |
| Q |
304 |
cgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||||| ||||||| ||| | |||||||||| || |||||| |||||| |||||||||| |
|
|
| T |
17623635 |
caaatggtggaaccccttcccgaatcctgcgtatgtggaagctttagtgcactgggttgccct |
17623697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 205 - 366
Target Start/End: Original strand, 17667973 - 17668135
Alignment:
| Q |
205 |
caactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacac |
303 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||| |||| | |||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
17667973 |
caactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaagaacctcttgtgtaaaaatcagggtaaggctgcgtacaatacac |
17668072 |
T |
 |
| Q |
304 |
cgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||||| ||||||| || ||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
17668073 |
caaatggtggaaccccttctcgaaccctgcgtatatgggagctttagtgcaccgggttgccct |
17668135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 5840982 - 5841163
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||| |||| || |||||||||||||||||||||| || |||||||||||||||||| |||||||||| |||| ||||| ||||||| |
|
|
| T |
5840982 |
gaggggtaaccttggtgcaaatgataaagttgttgtcatgtgactggaaggtcacgggttcaagtcctagaaacagccttttgtgtaaaaaatagggtaa |
5841081 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| ||||||||||||| | |||||||||||||||| |||||||| || |||||||||||||| |||||||| |||||||| |
|
|
| T |
5841082 |
ggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccct |
5841163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 194 - 366
Target Start/End: Original strand, 27573581 - 27573753
Alignment:
| Q |
194 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||| | ||||||||||||| | ||||| |||||||||||| |
|
|
| T |
27573581 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcattggttcaagtccgggcaacagcctcttgtgtataaacatggtaaggctgcg |
27573680 |
T |
 |
| Q |
294 |
tacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| |||||||| ||| || || |||||| ||||| ||||||||| ||||| ||||||||||| |
|
|
| T |
27573681 |
tacaatacaccaaatggtggaaccatttcccaaaccctgtgtatgtgggagctttagtgcatcgggttgccct |
27573753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 197 - 348
Target Start/End: Complemental strand, 99434 - 99285
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
|||||||||||| | |||||||||||||| ||||||| || |||||||||||||||||| |||||||||||||||| ||||||| || |||||||||||| |
|
|
| T |
99434 |
ccttggcgcaacag-taaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgta-aaaaacatggcaaggctgcgtac |
99337 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||| |||||||| ||||||| | ||||||| ||||||||||||||| |
|
|
| T |
99336 |
aatacaccaaatggtggaaccccttctcagaccctgtgtatgcgggagcttt |
99285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 198 - 364
Target Start/End: Complemental strand, 24860157 - 24859992
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtaca |
297 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| || || ||||||| ||| ||| |||||| ||||| || ||||||| |||| ||||||||||| |
|
|
| T |
24860157 |
cttggcgcaactggtaaaattgttgtcatgtgactggaaggttacgggtttaagccctggaaacaacctctggtgtaaaaacatggta-ggctgcgtaca |
24860059 |
T |
 |
| Q |
298 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||||| |||||| | ||||||| ||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
24860058 |
atacaccaaatggtagaaccccttctcggaccctgcgtatgcgggagctttagtgcaccggattgcc |
24859992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 190 - 356
Target Start/End: Complemental strand, 19977893 - 19977726
Alignment:
| Q |
190 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctc--ttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||| | || ||||||||||||||| || ||||||||||| ||||| ||||| ||| |||| |
|
|
| T |
19977893 |
ggggtaaccttggcggaactggtgaagttgttgtcatgtgaccgaaaggtcacgggttcaagttctggaaacagcctcttttgta-aaaaataggataag |
19977795 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
| ||||||||||||||| |||||||||| ||||| ||| ||| || ||||||||||||||| ||||||| |
|
|
| T |
19977794 |
gttgcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcacc |
19977726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 250 - 366
Target Start/End: Original strand, 36871509 - 36871624
Alignment:
| Q |
250 |
agtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
36871509 |
agtcctggaaacagcctcttgtgtgaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccgga-cctgcgtatgcgggagcttta |
36871607 |
T |
 |
| Q |
350 |
gtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36871608 |
gtgcaccgggttgccct |
36871624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 197 - 366
Target Start/End: Original strand, 44643486 - 44643656
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggtaaggctgcgt |
294 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||| || |||||| |||||||| || |||| |||||||| ||| |||||||| |||||||||||| |
|
|
| T |
44643486 |
ccttggcgcaa-tggtaaagttgtcatcatgtgactgaaaggtcacgtgttcaagttctagaaagagcctcttccgtaaaaaaacagagtaaggctgcgt |
44643584 |
T |
 |
| Q |
295 |
acaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| ||| |||||||||||||||| || |||||||||||||||||||| || |||||||||| |||||| |
|
|
| T |
44643585 |
acaatgtaccaaatggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcaccgggctgccct |
44643656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 189 - 366
Target Start/End: Original strand, 14544018 - 14544199
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| || || || ||| || || || |||||||||||| |||||||||||||||||| |
|
|
| T |
14544018 |
aggggtaaccttggcgcaattggtaaagttgttgtcatgtgactgaaaggttacaggtccaggtactggaaacagcctcttgtgtagaaaaacagggtaa |
14544117 |
T |
 |
| Q |
287 |
ggctgcgtacaata--caccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||| ||||| || |||||| ||||||||| | |||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
14544118 |
gactgcgtgcaataaccaaaaaatggtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgccct |
14544199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 209 - 366
Target Start/End: Complemental strand, 40417031 - 40416873
Alignment:
| Q |
209 |
tggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgta-gaaaaacagggtaaggctgcgtacaatacaccgaa |
307 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||| | |||||| ||||||||| |||||||||| ||||||| |||||||||||| | |
|
|
| T |
40417031 |
tggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcatggaaacaacctcttgtataaaaaacagggaaaggctgtgtacaatacaccaat |
40416932 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| |||||||| || ||||||||| |||||| ||||||| ||||||||||||||||| |
|
|
| T |
40416931 |
tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgccct |
40416873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 188 - 364
Target Start/End: Original strand, 7214488 - 7214667
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaa |
286 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||| || |||| ||||||||||| | ||||||| ||||||| |||| ||||||||| |
|
|
| T |
7214488 |
gaggggtaactttggcacaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcttggaaacagtctcttgtgtaaaatacagggtaa |
7214587 |
T |
 |
| Q |
287 |
ggctgcgtacaatacac--cgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||||||||||||||| ||||||| || ||||| ||||| ||||||||||| ||| ||| ||||||| ||||||| |
|
|
| T |
7214588 |
ggctgcgtacaatacacaaaaaatggtgagatcccttctcggacactgcgtatgcgagagttttagtgcaccaggttgcc |
7214667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 197 - 365
Target Start/End: Complemental strand, 4516522 - 4516354
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||| || ||||| ||||||| || ||||||||||||||| ||||| ||||| || |||||||| |
|
|
| T |
4516522 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacatattcaagttctagaaacagcctcttgtgtaaaaaacagggcaacgctgcgta |
4516424 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||||||||||| || |||||| ||| |||||| ||||| |
|
|
| T |
4516423 |
caatacaccaattggtgggaccccttcccggaccctgcgtatgtggaagctttagtgtaccgggctgccc |
4516354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 210 - 366
Target Start/End: Complemental strand, 21377232 - 21377076
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||||||||||||||||||||| || || ||| ||||||||| | |||||| |||||||| ||||| ||||||||||||| ||||||| |||| ||| |
|
|
| T |
21377232 |
ggtaaagttgttgtcatgtgactgaaaggttacgagttcaagtcatagaaacatcctcttgtgtaaaaaacagggtaaggctgggtacaatgcaccaaat |
21377133 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| ||| |||||||||||| ||||||||| |||||||| | |||||| |
|
|
| T |
21377132 |
ggtgggaccccttcccgaaccctgcgtatgtgggagcttt-gtgcaccgagctgccct |
21377076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 188 - 358
Target Start/End: Complemental strand, 26684803 - 26684630
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacag-cctcttgt--agaaaaacagggt |
284 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||||||||| || || |||| |||| ||||||| |||||| |||||||| | ||||| | ||| |
|
|
| T |
26684803 |
gaggggtaactttagcgcaactggtaaagttgttgtcatgtgattgaaaggtcaaaggtttaagtcctgaaaacagacctcttgtgtaaaaaaatatggt |
26684704 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
|||||||||||||||| || |||||||||||| ||| ||| |||||||||||||||||||||| |||||||| |
|
|
| T |
26684703 |
aaggctgcgtacaatatactaaatggtgggacctcttcccgaaccctgcgtatgcgggagctttaatgcaccgg |
26684630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 188 - 304
Target Start/End: Original strand, 17705449 - 17705566
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaa-aacagggtaa |
286 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||| ||||| ||||||||| ||| ||||| |||| |
|
|
| T |
17705449 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtcctggaaaccgcctcttgtgtaaacaacagagtaa |
17705548 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc |
304 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
17705549 |
ggctgtgtacaatacacc |
17705566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 189 - 349
Target Start/End: Complemental strand, 32781467 - 32781307
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaag |
287 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||| |||| ||| || |||||| ||||||||| |||||| |||||||| ||||| ||||||||| |
|
|
| T |
32781467 |
agggggaaccttggcgcaa-tggtaaagttgttgcaatgttgctgaaaggtcacgagttcaagtctcggaaacaacctcttgtgtaaaaaacagggtaag |
32781369 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
32781368 |
actgcgtacaatacaccaaatggtgggaccccttcccagaccctgtgtatgcgggagctttg |
32781307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 219 - 358
Target Start/End: Original strand, 25641487 - 25641626
Alignment:
| Q |
219 |
gttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccc |
318 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |||||||| | |||| |||||||||||| | ||||||||||||||| ||| ||||||||| |
|
|
| T |
25641487 |
gttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcattttgtgtgaaaacagggtaaagttgcgtacaatacaccaaattgtgggaccc |
25641586 |
T |
 |
| Q |
319 |
cttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||| ||| | |||||||||||| ||||||| ||| ||||| |
|
|
| T |
25641587 |
cttcccgaatcctgcgtatgcgagagctttagtgaaccgg |
25641626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 212 - 331
Target Start/End: Original strand, 5450263 - 5450384
Alignment:
| Q |
212 |
taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggtaaggctgcgtacaatacaccgaatg |
309 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||| |||| |||||| ||||| |||| ||||||| ||||||||||||||||||||||| || | |
|
|
| T |
5450263 |
taaagttgttgtcatgtgactgaaaggtcacgggttcaattcctggaaacaacctcttgtgtaaaaaaacatggtaaggctgcgtacaatacaccaaagg |
5450362 |
T |
 |
| Q |
310 |
gtgggaccccttgccggaccct |
331 |
Q |
| |
|
|||||||||||| | ||||||| |
|
|
| T |
5450363 |
gtgggaccccttcctggaccct |
5450384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 197 - 359
Target Start/End: Complemental strand, 17380407 - 17380247
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||| | || |||||||||||||||| | |||||| |||||||| | ||||||||||||| || || | |
|
|
| T |
17380407 |
ccttggcgcaa-tggcgaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcttggaaacaacctcttgtgtataaacagggtaaggttgtgtgc |
17380309 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
|||||||| |||| ||| ||||||| | |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
17380308 |
aatacaccaaatgatggaaccccttcctggaccctgcggatgcgggagcttt-gtgcaccggg |
17380247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 210 - 349
Target Start/End: Original strand, 33795261 - 33795401
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggtaaggctgcgtac-aatacaccga |
306 |
Q |
| |
|
|||||||||||||||| |||| || || ||||||||||||||||| |||||| |||||| ||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
33795261 |
ggtaaagttgttgtcacgtgattgaaaggtcacgggttcaagtcccggaaacaacctcttgggta-aaaaacagggtaaggctgcgtacaaatacacc-t |
33795358 |
T |
 |
| Q |
307 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
||||||||||||||| || ||||||| |||||||||||||||| |
|
|
| T |
33795359 |
atggtgggaccccttcccagaccctgtgtatgcgggagctttg |
33795401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 257 - 366
Target Start/End: Complemental strand, 40762346 - 40762236
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
||||||||||||||| ||||| | |||||||||| ||||||||||||| ||||||||||||| || | |||||||||||||| ||||||||| |||||| |
|
|
| T |
40762346 |
gaaacagcctcttgtgtaaaaaactgggtaaggctacgtacaatacaccaaatggtgggaccctttcctggaccctgcgtatgtgggagctttagtgcac |
40762247 |
T |
 |
| Q |
356 |
cgggttgccct |
366 |
Q |
| |
|
||||||||||| |
|
|
| T |
40762246 |
cgggttgccct |
40762236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 212 - 348
Target Start/End: Complemental strand, 31158598 - 31158459
Alignment:
| Q |
212 |
taaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttg--tagaaaaacagggtaaggctgcgtacaatacaccgaa-- |
307 |
Q |
| |
|
|||||||||||||||||||||| || |||| ||||| ||||| || ||||||||||||| || |||||||||||||| ||| ||||||| ||| || |
|
|
| T |
31158598 |
taaagttgttgtcatgtgactgaaaggtcaagggttaaagtcttcaaaacagcctcttgcgta-aaaaacagggtaagattgcatacaataaaccaaaaa |
31158500 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
31158499 |
tggtgggaccccttcccagaccctgcgtatgcgggagcttt |
31158459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 223 - 356
Target Start/End: Original strand, 19614981 - 19615116
Alignment:
| Q |
223 |
tcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgta-gaaaaacagggtaaggctgcgtacaatacacc--gaatggtgggacccc |
319 |
Q |
| |
|
||||||||||| || |||||||||||||||||| |||||| ||||||||| |||||||||||||| |||||||||||| ||| ||| || ||||||| |
|
|
| T |
19614981 |
tcatgtgactgaaaggtcacgggttcaagtccttgaaacatcctcttgtataaaaaacagggtaagactgcgtacaatataccaataatagt-ggacccc |
19615079 |
T |
 |
| Q |
320 |
ttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
|| ||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
19615080 |
ttcccgaaccctgcgtatgcaggagctttagtgcacc |
19615116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 274 - 366
Target Start/End: Original strand, 25632550 - 25632642
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||| |||| ||| ||| | |||||||||||||||| ||||||||||||||||| |
|
|
| T |
25632550 |
aaaaacaggataaggctgcgtacaatacaccaaatggtgggattccttcccgaaccttacgtatgcgggagctttagtgcaccgggttgccct |
25632642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 274 - 355
Target Start/End: Original strand, 24890452 - 24890533
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| | |||||||||||||| ||||||||||||||||| |||||||| |||||| |
|
|
| T |
24890452 |
aaaaacaaggtaaggctgcatacaatacaccaattggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 211 - 365
Target Start/End: Complemental strand, 45235976 - 45235820
Alignment:
| Q |
211 |
gtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
||||||||||| ||||||||||| || ||||| ||||||||||| ||||||| ||||| ||| || || ||||||||||| ||| ||||||| ||| |
|
|
| T |
45235976 |
gtaaagttgttctcatgtgactgaaagatcacgagttcaagtcctagaaacagtctcttctgtaaaataatagggtaaggctacgtgtaatacacaaaat |
45235877 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
||||||||||||| || |||||| ||||||| |||||||| ||| ||| ||||||| |
|
|
| T |
45235876 |
ggtgggaccccttaccagaccctacgtatgcaggagctttagtgtaccaagttgccc |
45235820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 210 - 330
Target Start/End: Complemental strand, 23145857 - 23145736
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||||||||||| ||||||| || |||||||||||||||| | |||||| ||||||| ||||| ||| |||||||||||||||||||||| | | |
|
|
| T |
23145857 |
ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaatt |
23145758 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccc |
330 |
Q |
| |
|
|||||||||| || |||||||| |
|
|
| T |
23145757 |
ggtgggaccctttcccggaccc |
23145736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 210 - 330
Target Start/End: Complemental strand, 23557647 - 23557526
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||||||||||| ||||||| || |||||||||||||||| | |||||| ||||||| ||||| ||| |||||||||||||||||||||| | | |
|
|
| T |
23557647 |
ggtaaagttgttgtagcgtgactgaaaggtcacgggttcaagtcttgaaaacagactcttgtgtaaaaaacagtgtaaggctgcgtacaatacaccaatt |
23557548 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccc |
330 |
Q |
| |
|
|||||||||| || |||||||| |
|
|
| T |
23557547 |
ggtgggaccctttcccggaccc |
23557526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 219 - 348
Target Start/End: Complemental strand, 31821491 - 31821363
Alignment:
| Q |
219 |
gttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccc |
318 |
Q |
| |
|
||||| ||||||||| || |||||| ||||||||| | ||||||||| |||| ||||| ||||||||| || |||||||||||| |||| |||||||| |
|
|
| T |
31821491 |
gttgttatgtgactgaaaggtcacgagttcaagtcgtagaaacagccgtgtgta-aaaaatagggtaaggttgtgtacaatacaccaaatgatgggaccc |
31821393 |
T |
 |
| Q |
319 |
cttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||| ||| | |||| ||||||||||||||| |
|
|
| T |
31821392 |
ctttccgaaacctgtgtatgcgggagcttt |
31821363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 206 - 287
Target Start/End: Original strand, 44604826 - 44604907
Alignment:
| Q |
206 |
aactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||| |||||||||||||||||||||| || ||||| |||||||||||| |||||| |||||||| |||||||||||||| |
|
|
| T |
44604826 |
aactgctaaagttgttgtcatgtgactggaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaag |
44604907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 185 - 233
Target Start/End: Complemental strand, 39189605 - 39189557
Alignment:
| Q |
185 |
attgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactg |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39189605 |
attgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactg |
39189557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 257 - 356
Target Start/End: Original strand, 30826060 - 30826158
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| ||||||||||||||| |||||| ||| ||||| || |||||| | |||||||||||||| ||||||| |
|
|
| T |
30826060 |
gaaacagcctcttgtgtaaaaatagggtaaggttgcgtacaatacaccaaatggt-ggaacccttcccagaccctacatatgcgggagctttagtgcacc |
30826158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 307 - 366
Target Start/End: Complemental strand, 40579810 - 40579751
Alignment:
| Q |
307 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
40579810 |
atggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccct |
40579751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 243 - 366
Target Start/End: Complemental strand, 15296533 - 15296408
Alignment:
| Q |
243 |
gggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcg |
340 |
Q |
| |
|
|||||||||||| |||||||||| |||| |||| ||||||||||||||||||||||| ||| || | |||||| ||||| ||||||||||||||| | |
|
|
| T |
15296533 |
gggttcaagtcccggaaacagcctgttgtgtaaaatacagggtaaggctgcgtacaatataccaaaatagtgggatcccttctcggaccctgcgtatgtg |
15296434 |
T |
 |
| Q |
341 |
ggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| ||||||||||| || || |||||| |
|
|
| T |
15296433 |
gaagctttggtgcgccaggctgccct |
15296408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 306 - 363
Target Start/End: Original strand, 23488556 - 23488613
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgc |
363 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
23488556 |
aatggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttgc |
23488613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 267 - 356
Target Start/End: Complemental strand, 39499331 - 39499242
Alignment:
| Q |
267 |
cttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
|||||| ||||| ||||||| ||||||||||||||| | |||||||||| ||||| || | |||||||||||||||||||| ||||||| |
|
|
| T |
39499331 |
cttgtataaaaatagggtaaagctgcgtacaatacatcaaatggtgggatcccttttcgaatcctgcgtatgcgggagctttagtgcacc |
39499242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 282 - 366
Target Start/End: Complemental strand, 13245181 - 13245097
Alignment:
| Q |
282 |
ggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| ||||||| ||| ||| |||||||||| ||| | ||||||||||| |
|
|
| T |
13245181 |
ggtaaggctgcgtacattacactaaatggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttgccct |
13245097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 307 - 366
Target Start/End: Original strand, 41409936 - 41409995
Alignment:
| Q |
307 |
atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
41409936 |
atggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct |
41409995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 223 - 344
Target Start/End: Complemental strand, 44449529 - 44449407
Alignment:
| Q |
223 |
tcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgta-gaaaaacagggtaaggctgcgtacaatacacc-gaatggtgggacccct |
320 |
Q |
| |
|
|||||| |||| || |||||| |||||| |||| ||||| ||||||| | |||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
44449529 |
tcatgtaactgaaaggtcacgagttcaa-tcctaaaaacaacctcttgaatgaaaaacaggataaggctgcgtacaatacaccaaaatagtgggacccct |
44449431 |
T |
 |
| Q |
321 |
tgccggaccctgcgtatgcgggag |
344 |
Q |
| |
|
| ||||||||||||| || ||||| |
|
|
| T |
44449430 |
tcccggaccctgcgtttgtgggag |
44449407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 308 - 366
Target Start/End: Original strand, 34080176 - 34080234
Alignment:
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||| ||| ||||||||||||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccct |
34080234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 308 - 366
Target Start/End: Original strand, 34766330 - 34766388
Alignment:
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtttccct |
34766388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 257 - 358
Target Start/End: Complemental strand, 30864528 - 30864427
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| ||||||||||| ||| |||||| || || || || ||||||||||||||| ||||| |||||||| |
|
|
| T |
30864528 |
gaaacagcctcttgtgtaaaaatagggtaagggtgcgtacaatataccaaatggtaagatcctttcccaaaccctgcgtatgcggaagcttcggtgcacc |
30864429 |
T |
 |
| Q |
357 |
gg |
358 |
Q |
| |
|
|| |
|
|
| T |
30864428 |
gg |
30864427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 238 - 358
Target Start/End: Original strand, 17471552 - 17471675
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgt--agaaaaacagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccctgcg |
334 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| | ||||||||| |||| |||||||||||| ||| |||| || |||||||| || |||||||| |
|
|
| T |
17471552 |
gtcacaggttcaagtctcagaaacagcctcttgtgtaaaaaaacaggataagactgcgtacaatataccaaaatgatgagaccccttccctgaccctgcc |
17471651 |
T |
 |
| Q |
335 |
tatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
|||||||||| ||| ||||||||| |
|
|
| T |
17471652 |
tatgcgggagttttagtgcaccgg |
17471675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 228 - 312
Target Start/End: Complemental strand, 2003678 - 2003592
Alignment:
| Q |
228 |
tgactgtaacgtcacgggttcaagtcctcgaaacagcctcttg--tagaaaaacagggtaaggctgcgtacaatacaccgaatggtg |
312 |
Q |
| |
|
|||||| || ||||||||| |||||||| ||||||||| |||| || ||||||||||||||| ||||||||||||| | ||||||| |
|
|
| T |
2003678 |
tgactgaaaggtcacgggtacaagtcctggaaacagccccttgcgtaaaaaaacagggtaaggatgcgtacaatacaacaaatggtg |
2003592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 323 - 366
Target Start/End: Original strand, 22371202 - 22371245
Alignment:
| Q |
323 |
ccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
22371202 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
22371245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 210 - 304
Target Start/End: Complemental strand, 29420048 - 29419949
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagg----gtaaggctgcgtacaatacacc |
304 |
Q |
| |
|
|||||||||||||||| |||||| || |||||| ||||||||||| |||||| |||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
29420048 |
ggtaaagttgttgtcacatgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagtaaggctgcgtacaatacacc |
29419949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 323 - 364
Target Start/End: Complemental strand, 124959 - 124918
Alignment:
| Q |
323 |
ccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
124959 |
ccggaccctgcgtatgcgggagctttagtgcaccgggttgcc |
124918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 313 - 366
Target Start/End: Original strand, 8575975 - 8576028
Alignment:
| Q |
313 |
ggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
8575975 |
ggaccccttcccggaccctgcgtatgtgggagctttagtgcaccaggttgccct |
8576028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 233
Target Start/End: Complemental strand, 27466311 - 27466266
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactg |
233 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27466311 |
gaggcgtaacattggcgcaactggtaaagttgttgtcatgtgactg |
27466266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 197 - 348
Target Start/End: Complemental strand, 44521544 - 44521393
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||| ||| |||||||||||| ||| ||||||| || |||||| |||||| || | |||||| ||||||| ||||| || ||||||||||| || |
|
|
| T |
44521544 |
ccttggcggaac-ggtaaagttgttatcacgtgactgaaaggtcacgcgttcaaatcttggaaacaatctcttgtgtaaaaaacaaggtaaggctgcata |
44521446 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||| ||||| |||| ||||| || ||| ||| ||| |||||||||| |
|
|
| T |
44521445 |
taatacaccaaatggcgggagcccttcccagacattgcatatacgggagcttt |
44521393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 297 - 348
Target Start/End: Complemental strand, 24059067 - 24059016
Alignment:
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
24059067 |
aatacaccatatggtgggacccctttccggaccctgcgtatgtgggagcttt |
24059016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 298 - 365
Target Start/End: Original strand, 31525771 - 31525838
Alignment:
| Q |
298 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
||||||| |||| |||||||| ||||| |||||||| |||||||||||||| ||| ||||| |||||| |
|
|
| T |
31525771 |
atacaccaaatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc |
31525838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 197 - 355
Target Start/End: Original strand, 35017781 - 35017942
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgac-tgtaacgtcacgggttcaagtcctcgaaa----cagcctcttgtagaaaaacagggtaaggctg |
291 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| || || |||||||||| ||||||| ||| ||||||| | || ||| ||| ||||| || |
|
|
| T |
35017781 |
ccttggcgcaac-ggtaaagttgttgtcatgtgacttgaaaggtcacgggtttaagtcctgaaaacagccagcctcatataaaaagacatggtaaaattg |
35017879 |
T |
 |
| Q |
292 |
cgtacaatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
| ||||||||||| |||||||||||||| |||| ||| |||||||||| |||||||| |||||| |
|
|
| T |
35017880 |
cctacaatacaccaaaatggtgggacccc-tgccagactctgcgtatgc-ggagctttagtgcac |
35017942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 314 - 366
Target Start/End: Complemental strand, 3633762 - 3633710
Alignment:
| Q |
314 |
gaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| |||||||| || |||||||||||||| |||||||| |||||||| |
|
|
| T |
3633762 |
gaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccct |
3633710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 211 - 366
Target Start/End: Original strand, 4795730 - 4795888
Alignment:
| Q |
211 |
gtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggtaaggctgcgtacaatacacc-gaa |
307 |
Q |
| |
|
||||||||||||||| ||||||| || ||||| ||| ||||| | |||||||||| | ||| ||||||| | | || |||||| ||||||||| || |
|
|
| T |
4795730 |
gtaaagttgttgtcacgtgactgaaaagtcacttgttgaagtcttgaaaacagcctcatgcgtaaaaaaacaagattagactgcgtgcaatacaccaaaa |
4795829 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| || ||||||| || |||||| | |||||| ||||| |||||||||| |
|
|
| T |
4795830 |
tggtgggaccttttcccggaccttgtgtatgccgaagctttagtgcagtgggttgccct |
4795888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 238 - 321
Target Start/End: Complemental strand, 12315782 - 12315699
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggacccctt |
321 |
Q |
| |
|
|||||| ||||||||| | |||||||| |||| | |||||||||||||| ||| |||||||||||| ||| ||| ||| |||| |
|
|
| T |
12315782 |
gtcacgagttcaagtcatggaaacagcttcttattaaaaaacagggtaagactgtgtacaatacaccaaatagtgagactcctt |
12315699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 189 - 271
Target Start/End: Original strand, 17472926 - 17473008
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| ||| || || |||||||||||| ||| | |||| ||||| |||| |
|
|
| T |
17472926 |
aggggtaaccttgacgcaactaataaagttgttgtcaaatgattgaaaggtcacgggttcaggtcttagaaatagcctattgt |
17473008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 306 - 348
Target Start/End: Complemental strand, 19185805 - 19185763
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
19185805 |
aatggtggaaccccttcctggaccctgcgtatgcgggagcttt |
19185763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 306 - 366
Target Start/End: Original strand, 1289095 - 1289156
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagc-tttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| ||||| | ||| ||||||||||| ||| ||||||||| ||||||| |
|
|
| T |
1289095 |
aatggtgggaccccttcccggatcatgcatatgcgggagcttttagtgcaccggattgccct |
1289156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 271
Target Start/End: Complemental strand, 4852388 - 4852312
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
||||||||||| |||||||| |||||||| |||||||| | || |||| ||||||||||||| |||||| ||||||| |
|
|
| T |
4852388 |
ggtaaccttggtgcaactggcaaagttgt---catgtgaccgaaaagtcaggggttcaagtcctgcaaacagtctcttgt |
4852312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 193 - 242
Target Start/End: Complemental strand, 39499390 - 39499341
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcac |
242 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||| | ||| ||||| |
|
|
| T |
39499390 |
gtaatcttggcgcaactggtaaagttgttatcatgtgattttaaggtcac |
39499341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 326 - 366
Target Start/End: Complemental strand, 23053007 - 23052967
Alignment:
| Q |
326 |
gaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| |||||| |
|
|
| T |
23053007 |
gaccctgcgtatgcaggagcttttgtgcaccgggctgccct |
23052967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 132; Significance: 2e-68; HSPs: 94)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 34725278 - 34725100
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | |||||||||||| |
|
|
| T |
34725278 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaa |
34725180 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
34725179 |
ggctgcgtacaatacactaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
34725100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 188 - 365
Target Start/End: Original strand, 46991781 - 46991959
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaa |
286 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| |||||| |||||||| |||| ||||||||| |
|
|
| T |
46991781 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa |
46991880 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
46991881 |
ggctgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttgccc |
46991959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 46248134 - 46247955
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaa |
286 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||| || |||||||||||||||| | ||||||||||||||| ||||| |||||||| |
|
|
| T |
46248134 |
gaggggtaaccttggctcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaa |
46248035 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
46248034 |
gactgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccct |
46247955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 32632737 - 32632559
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
32632737 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggtaag |
32632638 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| || ||||||| ||||||||||||| ||||||| |||| |||| |
|
|
| T |
32632637 |
gctgcgtacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttccct |
32632559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 38478461 - 38478284
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
38478461 |
gaggggtaaccttggcgcaactagtaaacttgttgtcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgt-gtaaaacagggtaag |
38478363 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||| |||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
38478362 |
gctgcgtacaatacaccaaatggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgccct |
38478284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 18944620 - 18944802
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||| ||| ||||||||||||||| ||||||||||||| |
|
|
| T |
18944620 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaaggcctggaaacagcctcttgtgtaaaaaacagggtaa |
18944719 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagc-tttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
18944720 |
ggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccct |
18944802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 27474257 - 27474436
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||| || ||||| |||||||||| | ||||||| ||||||| |||||||||| || |
|
|
| T |
27474257 |
tgaggggtaaccttagctcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcttggaaacagtctcttgtgtaaaaacagggcaa |
27474356 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
27474357 |
agctgcgtacaatacactgaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccct |
27474436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 14617014 - 14617194
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaa-aacagggta |
285 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| || |||||| ||||||||||| ||||||||||||||| ||| |||| |||| |
|
|
| T |
14617014 |
tgaggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacagcctcttgtgtaaataacaaggta |
14617113 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| ||||||||||||||| |||||||||| ||||| ||||||||||| |||||||||||||| |||||||||||| |||| |
|
|
| T |
14617114 |
aggttgcgtacaatacaccaaatggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggttaccct |
14617194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 194 - 366
Target Start/End: Complemental strand, 30395903 - 30395728
Alignment:
| Q |
194 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgc |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30395903 |
taaccttggcgcaactggtaaagttgttgtcatgtgactttaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgc |
30395804 |
T |
 |
| Q |
293 |
gtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||| || |||||||||||||| |||||||| |||||||| |
|
|
| T |
30395803 |
gtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgccct |
30395728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 20004273 - 20004092
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||| |||| ||||||| |||| |
|
|
| T |
20004273 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctctcgtgta-aaaaacaaggta |
20004175 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| || ||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
20004174 |
aggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccct |
20004092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 191 - 363
Target Start/End: Complemental strand, 23768498 - 23768325
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggc |
289 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||||||||||||| ||||| |||||||||| | ||||||||||||||| ||||| ||||||||||| |
|
|
| T |
23768498 |
gggtaacctcgacgcaactggtaaagttgttgtcatgtgactgtaaggtcacaggttcaagtcatggaaacagcctcttgtgtaaaaaacagggtaaggc |
23768399 |
T |
 |
| Q |
290 |
tgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgc |
363 |
Q |
| |
|
||||||||||||||| ||||||||||| |||| || ||||||||||||||||||||||| ||||| ||| |||| |
|
|
| T |
23768398 |
tgcgtacaatacaccaaatggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 193 - 365
Target Start/End: Original strand, 45402077 - 45402251
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggt--aagg-c |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || || || ||||||||||||||| ||||||||||||||| ||||||||||| ||| | |
|
|
| T |
45402077 |
gtaaccttggcgcaactggtaaagttgttgtcatgtga-tggaaggtaacgggttcaagtcctggaaacagcctcttgtgtaaaaacagggttcaagttc |
45402175 |
T |
 |
| Q |
290 |
tgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
45402176 |
tgcgtacaatacaccaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgccc |
45402251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 188 - 356
Target Start/End: Original strand, 47214488 - 47214655
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||| ||||||| ||||||||||||| |
|
|
| T |
47214488 |
gaggggtaactttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgt-ttaaaacagggtaag |
47214586 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
| ||||||||||||||| |||||||||||||||| || |||||||| |||||||||||| | ||||||| |
|
|
| T |
47214587 |
gttgcgtacaatacaccaaatggtgggaccccttcccagaccctgcatatgcgggagctctagtgcacc |
47214655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 10668197 - 10668383
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtga-----ctgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cag |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||||||| ||||||||||||||| ||||| || |
|
|
| T |
10668197 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacaa |
10668296 |
T |
 |
| Q |
282 |
ggtaaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| ||||||||||||||| | ||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10668297 |
ggtaaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccct |
10668383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 207 - 364
Target Start/End: Original strand, 6925096 - 6925254
Alignment:
| Q |
207 |
actggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgtacaatacaccg |
305 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||| |||| |||||||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
6925096 |
actggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaaaatagggtaaggctgcggacaatacaccg |
6925195 |
T |
 |
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
6925196 |
aatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgagttgcc |
6925254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 192 - 366
Target Start/End: Original strand, 19414420 - 19414593
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctg |
291 |
Q |
| |
|
||||||||||||| || |||||||||||||||||| |||||| || |||||||||||||||||| |||| |||||||| | | |||||||| |||||||| |
|
|
| T |
19414420 |
ggtaaccttggcgtaattggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctagaaagagcctcttat-gtaaaacaggttaaggctg |
19414518 |
T |
 |
| Q |
292 |
cgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| ||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
19414519 |
cgtacaatacaccaaatggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccct |
19414593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 188 - 364
Target Start/End: Complemental strand, 45812716 - 45812541
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| || ||||| |||||||||||| |||||| ||||||| | |||| |||||||| |
|
|
| T |
45812716 |
gaggggtaaccttggcgcaactgataaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctgaaaacagtctcttgt-gtaaaagagggtaag |
45812618 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||| || ||||||| |||||||||||| | ||||||||||||||| |
|
|
| T |
45812617 |
gctgcatacaatacaccaaatggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcaccgggttgcc |
45812541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 27201623 - 27201805
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||| ||| || ||||||||||||||||||||||||| || |||| ||||||||||||| ||||||||||||||| | |||||||||| |
|
|
| T |
27201623 |
tgaggggtaaccttagcgtaaatggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtcagaaacagggta |
27201722 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
27201723 |
aggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttgccct |
27201805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 197 - 366
Target Start/End: Complemental strand, 6983980 - 6983813
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||| || ||||| |||||||||||| ||||||||||| | || |||||||||||||| ||||||| |
|
|
| T |
6983980 |
ccttggcgcaa-tggtaaagttgttgtcacgtgactgaaaggtcacaggttcaagtcctggaaacagcctcgtata-aaaaacagggtaagtatgcgtac |
6983883 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||| || ||||||||||||||||||| |||||| |
|
|
| T |
6983882 |
aatacaccaaatggtgggacccctttccggaccctgcgtaggcaggagctttggtgcaccgggctgccct |
6983813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 198 - 349
Target Start/End: Original strand, 11596501 - 11596651
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtaca |
297 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||| || |||||||||||||||||| |||||| |||||||| |||||||||||||||||||||| | |
|
|
| T |
11596501 |
cttggcgcaac-ggtaaagtggctgtcatgtgactgaaatgtcacgggttcaagtcctagaaacaacctcttgtgtaaaaacagggtaaggctgcgtata |
11596599 |
T |
 |
| Q |
298 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
||||||| |||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
11596600 |
atacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagctttg |
11596651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 185 - 366
Target Start/End: Complemental strand, 41319990 - 41319808
Alignment:
| Q |
185 |
attgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacaggg |
283 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||| || ||||| |||| ||||||| ||||||| ||||||| |||||||||| |
|
|
| T |
41319990 |
attgaggggtaaccttgacacaactggtaaagttgttgtcatgtgactgaaaggtcacaggtttaagtcctggaaacagtctcttgtgtaaaaaacaggg |
41319891 |
T |
 |
| Q |
284 |
taaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||| ||| ||||| | |||||||||| || |||||| |||||||||| |
|
|
| T |
41319890 |
taaggctgcgtacaatacaccaaatgatgggaccccttcccgaacccttcatatgcgggagtttcagtgcactgggttgccct |
41319808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 225 - 366
Target Start/End: Complemental strand, 35253329 - 35253189
Alignment:
| Q |
225 |
atgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgcc |
324 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
35253329 |
atgtgactgaaagatcacgggttcaagtcctcgaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttccc |
35253231 |
T |
 |
| Q |
325 |
ggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| |||||||||||| | ||||||||| ||||||| |
|
|
| T |
35253230 |
ggaccctgcatatgcgggagctctagtgcaccggattgccct |
35253189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 194 - 366
Target Start/End: Complemental strand, 12127010 - 12126839
Alignment:
| Q |
194 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcg |
293 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| | || || |||||||||| |||| || |||||||| |||||| | ||||||||||||||||||| |
|
|
| T |
12127010 |
taaccttggcgcaactcgtaaagttgttgtcatgtaattgaaaggtcacgggtttaagttctggaaacagcttcttgt-gtaaaacagggtaaggctgcg |
12126912 |
T |
 |
| Q |
294 |
tacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| ||| |||||||||||| ||||||||||| |||||||||||| | |||||| | |||||||| |
|
|
| T |
12126911 |
tacaatacaccaaattgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcactgcgttgccct |
12126839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 188 - 333
Target Start/End: Complemental strand, 22930248 - 22930104
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||| |||||||||| |||| |||||||||||||| |
|
|
| T |
22930248 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagccttttgtgtaaaaacagggtaag |
22930149 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgc |
333 |
Q |
| |
|
| || | |||||||||| |||||||||||||||| | ||||||||| |
|
|
| T |
22930148 |
gttgtg-acaatacaccaaatggtgggaccccttcctggaccctgc |
22930104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 8197019 - 8197199
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||| || |||||||||||||||||| | || ||||||||| ||||||| |||| |
|
|
| T |
8197019 |
tgaggggtaaccttggtgcaactggtcaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggtaattgcctcttgtgtaaaaaacatggta |
8197118 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||| |||||| |||||| |||||| ||||||||| ||||||||||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
8197119 |
aggctacgtacagtacaccaaatggtaggaccccttctcggaccctgcgtatgttggagctttagtgtaccgggttgccct |
8197199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 198 - 349
Target Start/End: Complemental strand, 18724715 - 18724564
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
18724715 |
cttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggctgtgtac |
18724617 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||||||| | ||||||||||||||| |
|
|
| T |
18724616 |
aatacaccaaatcttgggaccccttcccggaccctacatatgcgggagctttg |
18724564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 193 - 366
Target Start/End: Complemental strand, 18742137 - 18741959
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcct-cgaaacagcctcttg--tagaaaaacagggtaaggc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || |||| |||||||| || | ||||||| || ||| || |||||||||||||||| |
|
|
| T |
18742137 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaaatcttgggaaacagtcttttgtataaaaaaacagggtaaggc |
18742038 |
T |
 |
| Q |
290 |
tgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| |||||||||||||||| || ||||||||||||||| ||||||| |||||||||||| |||| |
|
|
| T |
18742037 |
tgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtttccct |
18741959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 197 - 358
Target Start/End: Complemental strand, 2435958 - 2435796
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||| || |||||||||||||||||| ||||||||||| ||| |||||| |||||||| ||||||| |
|
|
| T |
2435958 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcctgtgtgaaaaatagggtaagcctgcgta |
2435860 |
T |
 |
| Q |
296 |
caatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||| || ||||||||||||| ||||||||| |
|
|
| T |
2435859 |
caatacaccaaaatggtgggacccctttccgtaccctccgcatgcgggagctttagtgcaccgg |
2435796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 274 - 366
Target Start/End: Original strand, 4349702 - 4349794
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4349702 |
aaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
4349794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 19932934 - 19932755
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct-tgtagaaaaacagggta |
285 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| || |||| |||||||||| | || ||| ||| | |||| |||||||||||| |
|
|
| T |
19932934 |
tgaggggttaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagt--tggatacaacctttgtgta-aaaaacagggta |
19932838 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| ||||||||||||||||| || | || ||||||| ||||||||| |
|
|
| T |
19932837 |
aggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct |
19932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 194 - 366
Target Start/End: Original strand, 9939443 - 9939620
Alignment:
| Q |
194 |
taaccttggcgcaactggtaaa-gttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaa-aaacagggtaaggctg |
291 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||| || |||||| ||||||||||| |||||| |||||||| || ||||| ||||||| || |
|
|
| T |
9939443 |
taaccttggcgcaaccggtaaaagttgttgtcatgtgactgaaaggtcacgagttcaagtcctggaaacaacctcttgtttaagaaacatggtaaggttg |
9939542 |
T |
 |
| Q |
292 |
cgtacaatacacc--gaatggtggga-ccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| ||||||||| |||||||||| |||||| ||||||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
9939543 |
cgtgcaatacaccaaaaatggtgggacccccttctcggaccctgcgtatgcgggagctttagtgcaccgggttaccct |
9939620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 227 - 366
Target Start/End: Original strand, 35005139 - 35005281
Alignment:
| Q |
227 |
gtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgc |
323 |
Q |
| |
|
||||||| || |||||||||||||||| | |||||||||||||| ||||| |||||||||||||| ||||||||||| || |||||||||||||| | |
|
|
| T |
35005139 |
gtgactgaaaggtcacgggttcaagtcttgaaaacagcctcttgtgtaaaaaacagggtaaggctgcatacaatacaccaaaaatggtgggaccccttcc |
35005238 |
T |
 |
| Q |
324 |
cggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
35005239 |
cggaccctgcgtatgcgggcgctttagtgcaccgggttgccct |
35005281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 210 - 359
Target Start/End: Complemental strand, 35117927 - 35117774
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacacc--ga |
306 |
Q |
| |
|
|||||||||||||||| ||||||| || |||||||||||||||||| |||| |||||||||| |||| |||||||||||||| |||||||||||| | |
|
|
| T |
35117927 |
ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaatagcctcttgtgtaaaatacagggtaaggctgtgtacaatacaccaaaa |
35117828 |
T |
 |
| Q |
307 |
atggtgggaccccttgccggaccctgcgt-atgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||| ||||||||||| ||||||||||||| |||| |||||||| |||||||||| |
|
|
| T |
35117827 |
atgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcaccggg |
35117774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 187 - 359
Target Start/End: Complemental strand, 44485290 - 44485119
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggta |
285 |
Q |
| |
|
||||||| | |||||||||||| | ||||||||||||||||||| || || |||||||||| |||||| |||||| || ||||| |||| ||| |||| |
|
|
| T |
44485290 |
tgagggggagccttggcgcaacag-taaagttgttgtcatgtgattgaaaggtcacgggttatagtcctggaaacaaccacttgtgtaaaagacatggta |
44485192 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||| ||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
44485191 |
aggctgcgtacaatacaccaaatggttggaccccttcccggatcctacgtatgcgggagcttt-gtgcaccggg |
44485119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 211 - 346
Target Start/End: Complemental strand, 25468421 - 25468285
Alignment:
| Q |
211 |
gtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatg |
309 |
Q |
| |
|
|||||||||||||||||||| || || |||| ||||||||||||| |||||| |||||||| ||||| |||||||||| ||||||||||||||| |||| |
|
|
| T |
25468421 |
gtaaagttgttgtcatgtgattgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaatcagggtaaggttgcgtacaatacaccaaatg |
25468322 |
T |
 |
| Q |
310 |
gtgggaccccttgccggaccctgcgtatgcgggagct |
346 |
Q |
| |
|
|| ||||| ||| || ||||||||||||||||||||| |
|
|
| T |
25468321 |
gttggacctcttcccagaccctgcgtatgcgggagct |
25468285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 252 - 366
Target Start/End: Complemental strand, 31382330 - 31382216
Alignment:
| Q |
252 |
tcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggt |
351 |
Q |
| |
|
|||| ||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||| | ||||||||| |||||||||||||| | |
|
|
| T |
31382330 |
tcctggaaacagcctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaatggtgggaccccttcctggaccctgcatatgcgggagctttact |
31382231 |
T |
 |
| Q |
352 |
gcaccgggttgccct |
366 |
Q |
| |
|
| ||||||||||||| |
|
|
| T |
31382230 |
gtaccgggttgccct |
31382216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 198 - 359
Target Start/End: Original strand, 20036208 - 20036369
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| || |||||||||||||||||| |||||| |||| |||| | | | |||||||| ||||| |
|
|
| T |
20036208 |
cttggcgcaa-tggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacaaactcttgtgtaaagagaaagggtaagattgcgtt |
20036306 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||||||||| |||||||| ||||||| ||||||||||||||||| |||| ||| |||||||||| |
|
|
| T |
20036307 |
caatacaccaaatggtggaaccccttcccggaccctgcgtatgcaggag-ttttgtgcaccggg |
20036369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 198 - 319
Target Start/End: Original strand, 33222971 - 33223093
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtaca |
297 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| || ||||||| || ||||| | ||||||||||||||| |||||||||| |||| |||||||| |
|
|
| T |
33222971 |
cttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcacggatttaagtcatggaaacagcctcttgtgtaaaaacagggaaaggttgcgtaca |
33223070 |
T |
 |
| Q |
298 |
atacacc-gaatggtgggacccc |
319 |
Q |
| |
|
||||||| |||||||||||||| |
|
|
| T |
33223071 |
atacaccaaaatggtgggacccc |
33223093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 197 - 356
Target Start/End: Original strand, 19701557 - 19701717
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| | ||||||||||||| |||||||| || |||||||||| ||||| | |||||||||||||| ||||| | ||||||| || ||| |
|
|
| T |
19701557 |
ccttggcgcaacag-taaagttgttgtcgtgtgactgaaatgtcacgggtttaagtcatgaaaacagcctcttgtgtaaaaaacttggtaaggatgggta |
19701655 |
T |
 |
| Q |
296 |
caatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
||||||||| || ||||||| |||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
19701656 |
caatacaccaaaatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcacc |
19701717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 197 - 366
Target Start/End: Original strand, 50811926 - 50812096
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggtaaggctgcgt |
294 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||| || ||||||| ||| ||||| |||||||| ||| |||| ||||||||||||||| ||||| |
|
|
| T |
50811926 |
ccttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacggaatcatgtcctggaaacagcttcttgtgtaaaaaaacagggtaaggttgcgt |
50812024 |
T |
 |
| Q |
295 |
acaatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| |||||| ||||||||| ||| ||||||||||||||||||||| ||||| ||| |||||| |
|
|
| T |
50812025 |
acaatacaccaaaatggt-ggaccccttcccgcgccctgcgtatgcgggagctttaatgcactgggctgccct |
50812096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 197 - 365
Target Start/End: Complemental strand, 10378896 - 10378738
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||||| || || ||||||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
10378896 |
ccttggtgcaac-ggtaaagttgttgtcacgtgactgaaaggttacgggttcaagtcctggaaa---------gtgagaaaacagggtaaggctgcgtac |
10378807 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||| |||||||||||||| |||||||||| ||||| |
|
|
| T |
10378806 |
aatacaccaaatggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccgggctgccc |
10378738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 197 - 364
Target Start/End: Original strand, 35019217 - 35019383
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||| || ||||| | |||||||||| ||||| ||||||||| ||||| ||| ||||||||| || |
|
|
| T |
35019217 |
ccttggcgcaac-ggtaaagttgttgtcacatgactgaaaggtcacagattcaagtcctgtaaacaacctcttgtataaaaatcagtataaggctgcata |
35019315 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||||||| | |||||||||||| | || ||||||||||||||| ||||||| |||||||||| |||| |
|
|
| T |
35019316 |
caatacaccaattggtgggacccc-tcccagaccctgcgtatgcgagagctttagtgcaccgggctgcc |
35019383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 245 - 361
Target Start/End: Complemental strand, 31442515 - 31442396
Alignment:
| Q |
245 |
gttcaagtcctcgaaacagcctctt--gtagaaaaacagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgg |
341 |
Q |
| |
|
||||||||| | |||||||||| || ||| ||||||||||||||| ||||||||||||||| || |||||||||||||| |||||| ||| ||||| || |
|
|
| T |
31442515 |
gttcaagtcttagaaacagccttttatgtaaaaaaacagggtaaggatgcgtacaatacaccaaaatggtgggaccccttcccggacactgtgtatgtgg |
31442416 |
T |
 |
| Q |
342 |
gagctttggtgcaccgggtt |
361 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31442415 |
gagctttggtgcaccgggtt |
31442396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 188 - 314
Target Start/End: Complemental strand, 4430207 - 4430080
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
||||| ||| ||||||||| |||||||||||||||||||||||||| || |||||||||| ||||| | |||||| |||||| ||||||||||||| |
|
|
| T |
4430207 |
gagggttaatcttggcgcagctggtaaagttgttgtcatgtgactggaaggtcacgggtttaagtcttgaaaacagtatcttgtgtaaaaaacagggtaa |
4430108 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtggg |
314 |
Q |
| |
|
| |||||||||||||||| ||||||||| |
|
|
| T |
4430107 |
gactgcgtacaatacaccaaatggtggg |
4430080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 197 - 354
Target Start/End: Complemental strand, 17470517 - 17470361
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||||| | |||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17470517 |
ccttggtgcaac-ggtaaagttgttgtcacgtgactgaatggtcatgggttcaagtcctagaaacagcctcttgtgtaaaaaacagggtaaggctgcgta |
17470419 |
T |
 |
| Q |
296 |
caatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
||||||||| ||| ||||||||| || || || |||||||||| ||||||||| ||||| |
|
|
| T |
17470418 |
caatacaccaaaatagtgggacccgtt-cctga-cctgcgtatgtgggagctttagtgca |
17470361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 197 - 366
Target Start/End: Complemental strand, 15511322 - 15511150
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcg-- |
293 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||| ||| || ||||| || ||||||| ||||| ||||||||| ||||| ||||||||||||||| |
|
|
| T |
15511322 |
ccttggcgcaa-tggtaaagttgttgtaatgtggctgaaaggtcacatattgaagtcctggaaaccgcctcttgtgtaaaaaacagggtaaggctgcgga |
15511224 |
T |
 |
| Q |
294 |
tacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| || |||||| ||||||| | |||||||||||||| | ||||||| |||||||||| |||||| |
|
|
| T |
15511223 |
tacaatacaccaaaatggtggtaccccttcctggaccctgcgtatgtgtgagctttagtgcaccgggctgccct |
15511150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 186 - 263
Target Start/End: Original strand, 34714598 - 34714675
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||| | ||||||| |
|
|
| T |
34714598 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgattgaaaggtcacgggttcaagtcatggaaacag |
34714675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 274 - 366
Target Start/End: Complemental strand, 1517405 - 1517313
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| | ||||||||||||||||||||| | |||||||||||||| | |||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
1517405 |
aaaaacatgataaggctgcgtacaatacaccaattggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccct |
1517313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 197 - 364
Target Start/End: Original strand, 22327086 - 22327250
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| || ||| |||||||||||||| |||||| |||||||| |||||||||||||||||| ||| |
|
|
| T |
22327086 |
ccttggcgcaac-ggcaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaaggctgtgta |
22327184 |
T |
 |
| Q |
296 |
caatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
| || |||| ||||||||| || ||| || ||| |||||||||||||||||||||||||| |||| |
|
|
| T |
22327185 |
cgatgcaccaaaatggtggg----gttcccgaactctgtgtatgcgggagctttggtgcaccgggctgcc |
22327250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 278 - 349
Target Start/End: Original strand, 15505632 - 15505703
Alignment:
| Q |
278 |
acagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15505632 |
acagggtaagactgcgtacaatacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttg |
15505703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 243 - 367
Target Start/End: Original strand, 22324925 - 22325050
Alignment:
| Q |
243 |
gggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcg |
340 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||| |||| | || ||||||||||||||| |
|
|
| T |
22324925 |
gggttcaagtcttggaaacagcctcttgtgtaaaaacagggtaaggctgcatacaatacaccaaaaatggtggagccccgt-cccgaccctgcgtatgcg |
22325023 |
T |
 |
| Q |
341 |
ggagctttggtgcaccgggttgccctg |
367 |
Q |
| |
|
|||||||| ||||||| || ||||||| |
|
|
| T |
22325024 |
ggagctttagtgcaccaggctgccctg |
22325050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 274 - 366
Target Start/End: Complemental strand, 42304303 - 42304209
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| |||||||||||||| || |||||||||||||| |||||||||||||||| ||||||||| ||||||||| ||||||| |
|
|
| T |
42304303 |
aaaaacagggtaaggttgcgtacaatacacaaaaaatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccggattgccct |
42304209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 197 - 359
Target Start/End: Original strand, 23371111 - 23371271
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
|||||||||||| | |||||||||| || |||||| || |||||||||||||||||| ||||||||| |||| ||||| ||| |||| || |||| |
|
|
| T |
23371111 |
ccttggcgcaacag-taaagttgttttcgcatgactgaaaggtcacgggttcaagtcctagaaacagccacttgggtaaaaaacgggcaaggttgtgtac |
23371209 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
|||||||| |||| ||||||||||| || ||||||||||||| || |||||| |||||||||| |
|
|
| T |
23371210 |
aatacaccaaatgctgggacccctt-ccagaccctgcgtatgtggtagctttagtgcaccggg |
23371271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 276 - 366
Target Start/End: Original strand, 43768205 - 43768295
Alignment:
| Q |
276 |
aaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| ||||||||||| | |||||||||||||| || |||||||||||| |||||||||| ||||||||| |||||| |
|
|
| T |
43768205 |
aaacagggtaaggctgcctacaatacaccaattggtgggaccccttcccagaccctgcgtatacgggagctttaatgcaccgggctgccct |
43768295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 190 - 255
Target Start/End: Original strand, 40424721 - 40424786
Alignment:
| Q |
190 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcct |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||| |
|
|
| T |
40424721 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggccacgggttcaagtcct |
40424786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 257 - 366
Target Start/End: Original strand, 23796511 - 23796621
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
||||||||||||||| ||||| || |||||| ||||||||||||||| ||||||| |||||||| || |||||||| ||||| |||||||| |||||| |
|
|
| T |
23796511 |
gaaacagcctcttgtgtaaaaatcaatgtaaggttgcgtacaatacaccaaatggtgagaccccttcccagaccctgcatatgctggagctttagtgcac |
23796610 |
T |
 |
| Q |
356 |
cgggttgccct |
366 |
Q |
| |
|
|||| |||||| |
|
|
| T |
23796611 |
cgggctgccct |
23796621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 191 - 289
Target Start/End: Original strand, 25290143 - 25290244
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaa--acagcctcttgt-agaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| || |||||| ||||||||| | ||| |||||||||||| |||||||||||||| |
|
|
| T |
25290143 |
gggtaaccttggcgcaacaggtaaagttgttgtcatgtgactgaaaggtcacgtgttcaagtcttggaaacacagcctcttgtgtaaaaaacagggtaag |
25290242 |
T |
 |
| Q |
288 |
gc |
289 |
Q |
| |
|
|| |
|
|
| T |
25290243 |
gc |
25290244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 221 - 366
Target Start/End: Complemental strand, 31272522 - 31272383
Alignment:
| Q |
221 |
tgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggacccct |
320 |
Q |
| |
|
||||| ||||||| || ||||| |||||||||||| |||||| |||||||| ||||||| |||||||||||||||| ||| | ||||||||| |
|
|
| T |
31272522 |
tgtcacgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaacatggtaaggctgcgtacagcacatcaaatggtggg------ |
31272429 |
T |
 |
| Q |
321 |
tgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||||||||||||||||||||||| ||| || ||| |||||| |
|
|
| T |
31272428 |
ttccggaccctgcgtatgcgggagctttagtggactgggctgccct |
31272383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 197 - 365
Target Start/End: Original strand, 52910204 - 52910379
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggtaaggctgcgt |
294 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| || ||||| ||||||| || | ||||||||||||| ||| |||||||||||| | ||| || |
|
|
| T |
52910204 |
ccttggtgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacaggttcaactcttggaaacagcctcttaggtaaaaaaacagggtaggactgtgt |
52910302 |
T |
 |
| Q |
295 |
acaatacaccga------atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
|||||||||| | ||||||||||||||| | ||| ||| |||||| |||| |||| ||||||| || ||||| |
|
|
| T |
52910303 |
acaatacacctaatggttatggtgggaccccttcctggaacctccgtatgtgggaactttagtgcaccaggctgccc |
52910379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 274 - 366
Target Start/End: Complemental strand, 20999944 - 20999852
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| || |||||||||||||||||||| |||| |||| |||||| | | |||||||||| ||||||||||| |||||||||| |||||| |
|
|
| T |
20999944 |
aaaaacaaggcaaggctgcgtacaatacaccaaatgatggggccccttccggcaccctgcgtacgcgggagctttagtgcaccgggctgccct |
20999852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 306 - 366
Target Start/End: Original strand, 50606499 - 50606559
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
50606499 |
aatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccct |
50606559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 197 - 304
Target Start/End: Complemental strand, 50760397 - 50760290
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtaga-aaaacagggtaaggctgcgta |
295 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||| | |||||||||||||||||| |||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
50760397 |
ccttggcgcaaa-ggtaaagtagttgtcatgtgactgagaggtcacgggttcaagtcctgaaaacagcctcttgtgtataaaactgggtaaggctgcgta |
50760299 |
T |
 |
| Q |
296 |
caatacacc |
304 |
Q |
| |
|
|||||||| |
|
|
| T |
50760298 |
taatacacc |
50760290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 192 - 348
Target Start/End: Complemental strand, 18335465 - 18335308
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggct |
290 |
Q |
| |
|
|||||||||||||||| || ||||||| |||||||||| ||| || ||||| ||| ||||||| ||||||| ||||||| ||||| ||||||| | | |
|
|
| T |
18335465 |
ggtaaccttggcgcaagtgataaagtttttgtcatgtgtctgaaaggtcacaagttaaagtcctggaaacagtctcttgtttaaaaattagggtaaagtt |
18335366 |
T |
 |
| Q |
291 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||||||| | |||| |||||||| || | |||| || |||| |||||||||| |
|
|
| T |
18335365 |
gcgtacaatacatcaaatgatgggaccctttcctagaccatgtgtatacgggagcttt |
18335308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 222 - 366
Target Start/End: Complemental strand, 19974221 - 19974076
Alignment:
| Q |
222 |
gtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacacc-gaatggtgggacccct |
320 |
Q |
| |
|
|||| ||||||| || ||||||||||||||| | ||||||||||| || ||||| |||| |||| ||||||||||||||| |||| |||||||| | |
|
|
| T |
19974221 |
gtcacgtgactgaaagatcacgggttcaagtcttggaaacagcctcaagtgtaaaaatagggcaaggttgcgtacaatacaccaaaatgatgggacccat |
19974122 |
T |
 |
| Q |
321 |
tgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||| || ||||||||||||||| |||||| ||| |||||| |
|
|
| T |
19974121 |
tcccggactctatgtatgcgggagctttagtgcacggggctgccct |
19974076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 257 - 338
Target Start/End: Original strand, 21723730 - 21723811
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatg |
338 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||| |||||||||||| |||||| | ||| || |||||||||||||||| |
|
|
| T |
21723730 |
gaaacagcctcttgtataaaaatagggtaaggctgagtacaatacaccaaatggtagaaccttttcccggaccctgcgtatg |
21723811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 245 - 356
Target Start/End: Complemental strand, 45264524 - 45264411
Alignment:
| Q |
245 |
gttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcggg |
342 |
Q |
| |
|
||||||||||| |||||| |||||||| ||||| ||| ||||||||| || ||||||||| || |||||||||||||| | |||||||| |||||||| |
|
|
| T |
45264524 |
gttcaagtcctggaaacaacctcttgtgcaaaaaacagagtaaggctgtgtgcaatacaccaaaatggtgggaccccttctcagaccctgcatatgcggg |
45264425 |
T |
 |
| Q |
343 |
agctttggtgcacc |
356 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
45264424 |
agctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 199 - 367
Target Start/End: Complemental strand, 34679388 - 34679216
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtaca |
297 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| || |||| |||| | |||| |||||| |||||||| ||||| ||||||||| |||||||| |
|
|
| T |
34679388 |
ttggcgcaac-ggtaaagttattgtcatgtgactgaaatatcacatgttccattcctagaaacaacctcttgtgtaaaaaacagggtaagactgcgtact |
34679290 |
T |
 |
| Q |
298 |
atacaccgaatggtgggaccccttgccggac----cctgcgtatgcgggagctttggtgcaccgggttgccctg |
367 |
Q |
| |
|
||||| | |||||||| |||| | || ||| |||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
34679289 |
atacatcaaatggtggagccccgttccagacccggcctgcgtatgcgggagctttagtacaccgggctgccctg |
34679216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 189 - 311
Target Start/End: Original strand, 24564322 - 24564445
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| ||||| || || ||| | | |||||||| | |||||| |||||||| |||||||||||||| |
|
|
| T |
24564322 |
aggggtaaccttggcgcaaccagtaaagttgatgtcttgtgattgaaaggtcgcagattcaagtcttggaaacaacctcttgtgtaaaaaacagggtaag |
24564421 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggt |
311 |
Q |
| |
|
| |||||||||| |||| |||||| |
|
|
| T |
24564422 |
ggtgcgtacaattcaccaaatggt |
24564445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 242 - 349
Target Start/End: Original strand, 30682845 - 30682951
Alignment:
| Q |
242 |
cgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgg |
341 |
Q |
| |
|
||||||||| |||| ||| |||||||||| ||||||| |||||| || ||||| |||| | |||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
30682845 |
cgggttcaaatcctgaaaatagcctcttgtgtaaaaacaaggtaagattgtgtaca-tacaacaaatggtgggaccccttcccggaccgtgcgtatgcgg |
30682943 |
T |
 |
| Q |
342 |
gagctttg |
349 |
Q |
| |
|
|||||||| |
|
|
| T |
30682944 |
gagctttg |
30682951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 301 - 363
Target Start/End: Complemental strand, 4587630 - 4587568
Alignment:
| Q |
301 |
caccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgc |
363 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
4587630 |
caccaaatggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttgc |
4587568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 269 - 345
Target Start/End: Complemental strand, 20982849 - 20982773
Alignment:
| Q |
269 |
tgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagc |
345 |
Q |
| |
|
|||| ||||| ||||||||||||| |||||||||| |||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
20982849 |
tgtaaaaaaatagggtaaggctgccaacaatacacctaatggtgggatctcttctcggaccctgcgtatgcgggagc |
20982773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 211 - 365
Target Start/End: Complemental strand, 39215117 - 39214961
Alignment:
| Q |
211 |
gtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa-t |
308 |
Q |
| |
|
|||||||| |||||| |||||| || ||| | |||||||| || |||||| |||||||| ||||| | |||||||||||||||||||| || || | |
|
|
| T |
39215117 |
gtaaagttattgtcacgtgactaaaaggtcccaagttcaagtactggaaacaacctcttgtgtaaaaaactgggtaaggctgcgtacaatattccaaaat |
39215018 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
|||||| |||||| || |||||||||||| || |||||| |||||||||| ||||| |
|
|
| T |
39215017 |
ggtgggtccccttcccaaaccctgcgtatgtggaagctttagtgcaccgggctgccc |
39214961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 274 - 345
Target Start/End: Complemental strand, 21910743 - 21910673
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagc |
345 |
Q |
| |
|
||||| ||||||||| ||||||||||||||| |||||||||||||||| ||| ||||| ||| ||||||||| |
|
|
| T |
21910743 |
aaaaatagggtaaggttgcgtacaatacaccaaatggtgggaccccttcccgaaccctacgt-tgcgggagc |
21910673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 269
Target Start/End: Original strand, 22151495 - 22151562
Alignment:
| Q |
202 |
gcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt |
269 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||| |||| ||||||||| || ||||||||||||| |
|
|
| T |
22151495 |
gcgcaactgataaagttgttgtcatctgactgtaaggtcataggttcaagttctggaaacagcctctt |
22151562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 197 - 346
Target Start/End: Complemental strand, 27136823 - 27136673
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
||||||| |||| |||||||||||||||| |||| || || | |||| |||||||| || | |||| |||||||| ||||| || ||||||| |||||| |
|
|
| T |
27136823 |
ccttggcacaac-ggtaaagttgttgtcacgtgattggaaggacacgagttcaagttctgggaacaacctcttgtgtaaaaaacatggtaaggttgcgta |
27136725 |
T |
 |
| Q |
296 |
caatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagct |
346 |
Q |
| |
|
||||||||| |||||||||||||||| | || | || ||||||||||||| |
|
|
| T |
27136724 |
caatacaccaaaatggtgggaccccttcctagatcatgtgtatgcgggagct |
27136673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 197 - 267
Target Start/End: Complemental strand, 2436064 - 2435995
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctc |
267 |
Q |
| |
|
|||||| ||||| |||||||||||||||| ||||||| || |||||||||||||||||| |||||| |||| |
|
|
| T |
2436064 |
ccttggtgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcctggaaacaacctc |
2435995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 287 - 353
Target Start/End: Complemental strand, 4430080 - 4430014
Alignment:
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgc |
353 |
Q |
| |
|
|||||||||||||||||| |||||||| ||||||| | ||| |||| ||||||||||||||| |||| |
|
|
| T |
4430080 |
ggctgcgtacaatacaccaaatggtggaacccctttctggatcctgtgtatgcgggagctttagtgc |
4430014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 189 - 271
Target Start/End: Original strand, 21723642 - 21723723
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||| | || || |||| |||||| ||||||||||||||| |
|
|
| T |
21723642 |
aggggtaaccttcgcacaactggtaaagttgttgtcatgtgactggatggttacaagttc-agtcctggaaacagcctcttgt |
21723723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 306 - 359
Target Start/End: Original strand, 30555211 - 30555264
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
30555211 |
aatggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccggg |
30555264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 274 - 348
Target Start/End: Original strand, 6358185 - 6358260
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||| || |||||||||||||| || |||||||||||||| ||| |||| |
|
|
| T |
6358185 |
aaaatcagggtaaagctgcgtacaaaacaccaaaatggtgggaccccttcccagaccctgcgtatgcaggatcttt |
6358260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 308 - 355
Target Start/End: Complemental strand, 33594191 - 33594144
Alignment:
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
33594191 |
tggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcac |
33594144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 291 - 348
Target Start/End: Complemental strand, 4249520 - 4249463
Alignment:
| Q |
291 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||| ||| || ||||||||||||||| |
|
|
| T |
4249520 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagcttt |
4249463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 291 - 348
Target Start/End: Complemental strand, 4249844 - 4249787
Alignment:
| Q |
291 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||| ||| || ||||||||||||||| |
|
|
| T |
4249844 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagcttt |
4249787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 291 - 348
Target Start/End: Complemental strand, 4250168 - 4250111
Alignment:
| Q |
291 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||||||||| |||||||||| ||||| ||| ||| || ||||||||||||||| |
|
|
| T |
4250168 |
gcgtacaatacaccaaatggtgggatcccttcccgaaccttgtgtatgcgggagcttt |
4250111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 188 - 229
Target Start/End: Original strand, 10163736 - 10163777
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtg |
229 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
10163736 |
gaggggtaacattggcgcaactgataaagttgttgtcatgtg |
10163777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 215 - 348
Target Start/End: Complemental strand, 49722726 - 49722593
Alignment:
| Q |
215 |
agttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtggg |
314 |
Q |
| |
|
||||||||||| |||| || || |||||||||| ||||| | ||||| ||||||||| || || |||||||| ||||||||||| | || |||||| |
|
|
| T |
49722726 |
agttgttgtcacgtgaatgaaaggtcacgggtttaagtcatgtaaacaacctcttgtaaaataatagggtaagattgcgtacaatatattgattggtgga |
49722627 |
T |
 |
| Q |
315 |
accccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||||| || ||| |||||||| || |||||| |
|
|
| T |
49722626 |
accccttcccaaaccttgcgtatgtggcagcttt |
49722593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 204 - 298
Target Start/End: Complemental strand, 14988084 - 14987989
Alignment:
| Q |
204 |
gcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaa |
298 |
Q |
| |
|
||||||||||||||||||||||| ||||| || ||||| ||||||||||| |||||| |||| | |||| ||||| ||||||||||||||| |
|
|
| T |
14988084 |
gcaactggtaaagttgttgtcatatgactagaaagtcacaagttcaagtcctgaaaacagtatcttatgtaaaatacaggataaggctgcgtacaa |
14987989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 282 - 348
Target Start/End: Complemental strand, 20169175 - 20169109
Alignment:
| Q |
282 |
ggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||| ||| ||||||||| || | |||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
20169175 |
ggtaagactgtgtacaataccccaatcggtgggactccttcccggaccctgcatatgcgggagcttt |
20169109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 197 - 271
Target Start/End: Complemental strand, 25554893 - 25554820
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||| || | |||| ||| ||||||| |||||| |||||||| |
|
|
| T |
25554893 |
ccttggcgcaa-tggtaaagttgttgtcacgtgactaaaaggccacgtgtttaagtcctggaaacaacctcttgt |
25554820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 273 - 354
Target Start/End: Original strand, 43207558 - 43207640
Alignment:
| Q |
273 |
gaaaaacagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
||||||||||||||| | || ||||||||||| || |||||||||| ||| || |||||| ||||||| ||||||| ||||| |
|
|
| T |
43207558 |
gaaaaacagggtaagacggcatacaatacaccaaattggtgggacctcttcccagaccctatgtatgcgagagctttagtgca |
43207640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 274 - 359
Target Start/End: Original strand, 46859130 - 46859216
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||||||| | || | | || |||||||| ||||| ||| |||||||||| |
|
|
| T |
46859130 |
aaaaacagggtaagactgcgtacaatacaccaaaatggtgggactcattttcaggccttgcgtatgtgggagttttagtgcaccggg |
46859216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 187 - 215
Target Start/End: Original strand, 4349675 - 4349703
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4349675 |
tgaggggtaaccttggcgcaactggtaaa |
4349703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 192 - 252
Target Start/End: Original strand, 21006125 - 21006185
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagt |
252 |
Q |
| |
|
|||||||||| |||||| |||||| ||||||||||| ||||| || |||| ||||||||| |
|
|
| T |
21006125 |
ggtaaccttgacgcaaccggtaaaattgttgtcatgcgactgaaaggtcaaaggttcaagt |
21006185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 314 - 358
Target Start/End: Complemental strand, 25554796 - 25554752
Alignment:
| Q |
314 |
gaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| || ||||||||| |
|
|
| T |
25554796 |
gaccccttcccgaaccctgcgtatgcgggagcattagtgcaccgg |
25554752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 131; Significance: 7e-68; HSPs: 81)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 21172188 - 21172011
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
21172188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaag |
21172090 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
21172089 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
21172011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 186 - 366
Target Start/End: Original strand, 32758213 - 32758392
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| ||||||||||||||| | ||||||||||| |
|
|
| T |
32758213 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgt-gtaaaacagggta |
32758311 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
32758312 |
aggctgtgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
32758392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 182 - 366
Target Start/End: Complemental strand, 2541207 - 2541021
Alignment:
| Q |
182 |
ttcattgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacg-tcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-c |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||||||||||||||||| ||||||||||||||| ||||| | |
|
|
| T |
2541207 |
ttcattgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaac |
2541108 |
T |
 |
| Q |
280 |
agggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||| |||| ||||||||||||||||||||| |||||||||||| |||| |
|
|
| T |
2541107 |
agggtaaggctgcgtactatacaccaaatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtttccct |
2541021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 168 - 366
Target Start/End: Complemental strand, 35335014 - 35334818
Alignment:
| Q |
168 |
tatataaaatcattttcattgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctc |
267 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||| ||||||| ||| |
|
|
| T |
35335014 |
tatataaactcagtttcat-gagggataaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgagttcaagtcctggaaacagtctc |
35334916 |
T |
 |
| Q |
268 |
ttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| |||||||||||||| ||| ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
35334915 |
gtgta-aaaaacagggtaagactgtgtacaatacaccgaatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtttccct |
35334818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 121; E-Value: 7e-62
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 48735303 - 48735124
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcg-aaacagcctcttgtagaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| | ||||| |||||||| | |||||| |||| |
|
|
| T |
48735303 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtccttggaaacaacctcttgt-gtaaaacacggta |
48735205 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
48735204 |
aggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
48735124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 195 - 366
Target Start/End: Complemental strand, 10693245 - 10693075
Alignment:
| Q |
195 |
aaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgt |
294 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
10693245 |
aaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaagagggtaaggctgcgt |
10693147 |
T |
 |
| Q |
295 |
acaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||| |||||||||||| | |||||| |||||||||| |
|
|
| T |
10693146 |
acaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcactgggttgccct |
10693075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 116; E-Value: 7e-59
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 42805477 - 42805659
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
42805477 |
tgaggggtaaccttggcgtaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggta |
42805576 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
42805577 |
aggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
42805659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 47716413 - 47716594
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| |||||||||| || |||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
47716413 |
gaggggtaaccttggcacaactggaaaagttgttgccatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaa |
47716512 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
47716513 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgccct |
47716594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 113; E-Value: 4e-57
Query Start/End: Original strand, 194 - 366
Target Start/End: Original strand, 40463837 - 40464009
Alignment:
| Q |
194 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcg |
293 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||| | ||||||| ||||||| |||||| ||||||||||||| |
|
|
| T |
40463837 |
taaccttggcgcaaccggtaaagttgttgtcatgtgactgtaaggtcacgggttcaagtcatagaaacagtctcttgtgtaaaaactgggtaaggctgcg |
40463936 |
T |
 |
| Q |
294 |
tacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| |||||||| |||||||||||||||| |||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
40463937 |
tataatacaccaaatggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgccct |
40464009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 42798623 - 42798802
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| | ||||||| ||||||| ||||||| ||||| |
|
|
| T |
42798623 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaagtcttggaaacagtctcttgtgtaaaaaacaaggtaa |
42798722 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||||||||| |||||||||||| | ||||| ||||||||||| |
|
|
| T |
42798723 |
ggctgcgtacaatacaccaaatggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgccct |
42798802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 34626389 - 34626210
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| || || | ||| | |||||||||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
34626389 |
tgaggggtaaccttagcgcaactggtaaagttgttgtcatgtgattgaaaggccacagattcaagtcctggaaacagcctcctgtgtaaaaacagggtaa |
34626290 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| ||||||||| |||||||||| ||||| |||||||||||||||||||||||||| || || ||||||||||| |
|
|
| T |
34626289 |
ggctgcgttcaatacaccaaatggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttgccct |
34626210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 195 - 366
Target Start/End: Complemental strand, 11617762 - 11617590
Alignment:
| Q |
195 |
aaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcg |
293 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| || ||||| |||||||||||| |||||| |||||||| ||||| ||||||||| ||||| |
|
|
| T |
11617762 |
aacctcggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaagactgcg |
11617663 |
T |
 |
| Q |
294 |
tacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||||||||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
11617662 |
tacaatacaccaaatggtgggaccccttcctggaccctgcgtatgcaggacctttagtgcaccgggttgccct |
11617590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 43557426 - 43557608
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| || |||| ||||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
43557426 |
gaggggtaaccttgccgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaaaaacagagtaa |
43557525 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagc-tttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| | |||||| |||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
43557526 |
ggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttttagtgcaccgggttgccct |
43557608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 216 - 366
Target Start/End: Complemental strand, 42391251 - 42391102
Alignment:
| Q |
216 |
gttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtggga |
315 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||| |||||||| |||||| | |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42391251 |
gttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcttcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatggtggga |
42391153 |
T |
 |
| Q |
316 |
ccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
42391152 |
ccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
42391102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 196 - 366
Target Start/End: Original strand, 27629596 - 27629767
Alignment:
| Q |
196 |
accttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| | || |||||||||||||||||| ||||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
27629596 |
accttggcgcaactggtaaagttgttgtcatttgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaaggttgcgt |
27629695 |
T |
 |
| Q |
295 |
acaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||||| |||||||||||||||| |||| |||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
27629696 |
aaaatacaccaaatggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttgccct |
27629767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 98; E-Value: 4e-48
Query Start/End: Original strand, 238 - 367
Target Start/End: Complemental strand, 18512583 - 18512454
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
337 |
Q |
| |
|
|||||||||||||||||| |||||| | |||||| ||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18512583 |
gtcacgggttcaagtcctggaaacaacatcttgtgtaaaaatagggtaaggctgcgtacaatacaccgaatggtgggaccccttcccggaccctgcgtat |
18512484 |
T |
 |
| Q |
338 |
gcgggagctttggtgcaccgggttgccctg |
367 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |
|
|
| T |
18512483 |
gcgggagctttggtgcactgggttgccctg |
18512454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 208 - 364
Target Start/End: Complemental strand, 33872070 - 33871914
Alignment:
| Q |
208 |
ctggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaa |
307 |
Q |
| |
|
|||||||||||||||||||||||||| || ||| |||||||||||||| |||||| |||||||| ||||||||| ||||||||||||||||||||| || |
|
|
| T |
33872070 |
ctggtaaagttgttgtcatgtgactgaaaggtcgcgggttcaagtcctggaaacaacctcttgtgtaaaaacaggataaggctgcgtacaatacaccaaa |
33871971 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||| ||||||| ||||||| ||||||| |
|
|
| T |
33871970 |
tggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 187 - 348
Target Start/End: Complemental strand, 28078313 - 28078152
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||| |||||||||| || ||||||||||||||||||||||| |||||||||||||||||| ||||||| ||| |||| ||||||||||||| |
|
|
| T |
28078313 |
tgaggggtaaccctggcgcaactcgtgaagttgttgtcatgtgactgtaaggtcacgggttcaagtcctagaaacagtctcgtgtaaaaaaacagggtaa |
28078214 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|| ||| | ||||||||| |||||||||||||||| ||| | ||||| |||||| ||||||| |
|
|
| T |
28078213 |
ggttgcatgcaatacaccaaatggtgggaccccttcccgaatcctgcatatgcgagagcttt |
28078152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 199 - 366
Target Start/End: Complemental strand, 19427059 - 19426892
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtaca |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | || |||||||||||||||||| ||||||||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
19427059 |
ttggcgcaactggtaaagttgttgtcatgtgaccgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaatagggtaagactgcgtaca |
19426960 |
T |
 |
| Q |
298 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| |||||||||| ||||| |||||||||| |||||| |||||| ||||||||||||||||| |
|
|
| T |
19426959 |
atacaccaaatggtggga-cccttctcggaccctgcatatgcgagagcttcagtgcaccgggttgccct |
19426892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 188 - 364
Target Start/End: Complemental strand, 47078034 - 47077859
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||| ||||||| | |||| || |||| |
|
|
| T |
47078034 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagtctcttgt-gtaaaatagagtaaa |
47077936 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
| |||||||||||||| |||||||||||||||| || ||||| | |||||||||||| | ||||||||| ||||| |
|
|
| T |
47077935 |
gttgcgtacaatacacaaaatggtgggaccccttcccaaaccctacatatgcgggagctctagtgcaccggattgcc |
47077859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 188 - 339
Target Start/End: Original strand, 46354148 - 46354302
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || || |||||||||||||||||| |||||| |||||||| ||||||||||||| |
|
|
| T |
46354148 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgattggaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaaaacagggtaa |
46354247 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgc |
339 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| |||||||| || ||||| |
|
|
| T |
46354248 |
ggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 42476826 - 42477004
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||| || ||||||| ||||||| || ||||||| ||||||| | |||||| ||||| |
|
|
| T |
42476826 |
tgaggggtaacattggcgtaactggtaaagttgttgtcatgtgactaaaaggtcacggattcaagttctggaaacagtctcttgt-gtaaaacaaggtaa |
42476924 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| | | | |||| |||||||||||| | ||||||| ||||||||| |
|
|
| T |
42476925 |
ggctgcgtacaatacaccaaatggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccct |
42477004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 199 - 366
Target Start/End: Original strand, 19265781 - 19265946
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaa |
298 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||| || |||||||||||||||| | || |||||| ||||| ||||| ||||||||||||||||||| |
|
|
| T |
19265781 |
ttggcgcaac-ggtaaagttgttgtcacgtgactgaaaggtcacgggttcaagtcttggatacagccgcttgtgtaaaaagagggtaaggctgcgtacaa |
19265879 |
T |
 |
| Q |
299 |
tacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||| |||||||||||||||| ||||| ||| | |||| ||||||||| |||||||||| |||||| |
|
|
| T |
19265880 |
tacaccaaatggtgggaccccttcccgga-cctacatatgtgggagctttagtgcaccgggctgccct |
19265946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 22699151 - 22698969
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| || || | ||||||||||||| |||| || ||||||| ||||||||||||| |
|
|
| T |
22699151 |
gaggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggttatgggttcaagtcctggaaatagtctcttgtgtaaaaaacagggtaa |
22699052 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccc-cttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||||||||||||| ||||||||||||| || |||||||||| ||||||||||||| | |||||||||||| |||| |
|
|
| T |
22699051 |
gactgcgtacaatacaccaaaaatggtgggacccttttcccggaccctgtgtatgcgggagctatagtgcaccgggttaccct |
22698969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 188 - 349
Target Start/End: Original strand, 13805057 - 13805217
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacaggg-taa |
286 |
Q |
| |
|
|||||| | ||||||||||| ||||||||||||||||||||||||| || || ||||||||||||||| |||| ||||||| || | ||||||||| ||| |
|
|
| T |
13805057 |
gagggggagccttggcgcaa-tggtaaagttgttgtcatgtgactgaaaggtaacgggttcaagtcctggaaatagcctctggt-gtaaaacaggggtaa |
13805154 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
||||| |||||||||||| |||||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
13805155 |
ggctgtgtacaatacaccaaatggtgggaccacttcctggaccctgcgtatgcgggagctttg |
13805217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 200 - 356
Target Start/End: Original strand, 39123857 - 39124018
Alignment:
| Q |
200 |
tggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggt----aaggctgcgta |
295 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||| |||||||||||||||| ||||| | ||||||| ||||||||||| ||||||||||| |
|
|
| T |
39123857 |
tggcgcaa-tggtaaagttgttgtcatgtgactgaaacgacacgggttcaagtcctagaaacggtctcttgtgtaaaaacagggtagggaaggctgcgta |
39123955 |
T |
 |
| Q |
296 |
caatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcacc |
356 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
39123956 |
aaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgagggagctttggtgcacc |
39124018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 238 - 366
Target Start/End: Original strand, 7879642 - 7879771
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgta |
336 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||| || ||||||||||||||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
7879642 |
gtcacgggttcaagtcctggaaacaatctcttgtgtaaaaaacaaggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgta |
7879741 |
T |
 |
| Q |
337 |
tgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| ||||||||||||||||| |
|
|
| T |
7879742 |
tgcgggagcttcagtgcaccgggttgccct |
7879771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 187 - 288
Target Start/End: Complemental strand, 42496017 - 42495916
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
42496017 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatatgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaacagggtaa |
42495918 |
T |
 |
| Q |
287 |
gg |
288 |
Q |
| |
|
|| |
|
|
| T |
42495917 |
gg |
42495916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 188 - 346
Target Start/End: Complemental strand, 2663112 - 2662958
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||| | |||| |||||||||||| ||||||||||||||| | |||| |||||||| |
|
|
| T |
2663112 |
gaggggtaaccttggcgcaactagtaaagttgttgttatgtgactgga--gtcataggttcaagtcctggaaacagcctcttgt-gtaaaatagggtaag |
2663016 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagct |
346 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||| | |||||||| |||||||||||| |
|
|
| T |
2663015 |
gctgcgtacaatacaccaaatggtggga-cccttttcagaccctgcatatgcgggagct |
2662958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 192 - 358
Target Start/End: Complemental strand, 14732999 - 14732831
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcct--cttgtagaaaaacagggtaaggc |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||| |||||||||| | |||| |||||||||||||||| |
|
|
| T |
14732999 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaagtcatgggttcaagtcctggaaacagcctcccatgta-aaaaacagggtaaggc |
14732901 |
T |
 |
| Q |
290 |
tgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||||| ||||||||| ||||||| || |||| ||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
14732900 |
tgcgt-caatacaccaaaaatggtgaaactccttcccgaaccctgtttatgcgggagctttagtgcaccgg |
14732831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 197 - 359
Target Start/End: Complemental strand, 28362316 - 28362155
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| ||| || ||||| |||||||||||| ||||| ||||||||| ||||| | |||||||||||||| |
|
|
| T |
28362316 |
ccttggcgcaac-ggtaaagttgttgtcatgtggctgaaaggtcacaggttcaagtcctagaaactgcctcttgtgtaaaaaacttggtaaggctgcgta |
28362218 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||||||||| |||||||||||||||| || |||| ||| |||| ||||||||| |||||||||| |
|
|
| T |
28362217 |
caatacaccaaatggtgggaccccttcccagaccttgcatatgtgggagcttt-gtgcaccggg |
28362155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 189 - 291
Target Start/End: Original strand, 18326989 - 18327091
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaagg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
18326989 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgacttgaaggtcacgggttcaagtcccggaaacagcctcttgtgtaaaaacagggtaagg |
18327088 |
T |
 |
| Q |
289 |
ctg |
291 |
Q |
| |
|
||| |
|
|
| T |
18327089 |
ctg |
18327091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 197 - 366
Target Start/End: Complemental strand, 23419845 - 23419676
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| || ||||| ||||||||| || ||||||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
23419845 |
ccttggcgcaac-ggtaaagttgctgtcatgtgactaaaaggtcacaggttcaagttctggaaacagcctcttgtgtaaaaaacagggtaagactgcgta |
23419747 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| |||||||||||||||| | |||| ||||| |||||| ||||| ||||| |||| |||||| |
|
|
| T |
23419746 |
caatacaccaaatggtgggaccccttcctagaccttgcgtgtgcgggggctttagtgcatcgggctgccct |
23419676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 210 - 366
Target Start/End: Original strand, 29907393 - 29907551
Alignment:
| Q |
210 |
ggtaaagttgttgt--catgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaatacacc-g |
305 |
Q |
| |
|
|||||||||||||| |||||||||| || |||||||||||||||||| ||||||||||||||| ||||| || |||||||||||| ||||||||| |
|
|
| T |
29907393 |
ggtaaagttgttgtatcatgtgactgaaaggtcacgggttcaagtcctagaaacagcctcttgtgtaaaaaatagtgtaaggctgcgttcaatacaccaa |
29907492 |
T |
 |
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| | ||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
29907493 |
aatggtgggaccccatcccggaccct--gtatgcgggagctttagtgcaccgggttgccct |
29907551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 213 - 366
Target Start/End: Original strand, 11741774 - 11741926
Alignment:
| Q |
213 |
aaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtg |
312 |
Q |
| |
|
||||||||||||||||||||| || |||| ||||||||||||| ||||||| ||| || | |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
11741774 |
aaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacagcttctagt-gtaaaatagggtaaggctgcgtacaatacaccaaatggtg |
11741872 |
T |
 |
| Q |
313 |
ggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| ||||| ||||| |||| ||||||||||| | ||||||||||||||||| |
|
|
| T |
11741873 |
ggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgccct |
11741926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 197 - 347
Target Start/End: Original strand, 19266414 - 19266564
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttg--tagaaaaacagggtaaggctgcgt |
294 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| || ||| ||||||||||||| ||| |||| |||| || ||||||||||||||||||||| |
|
|
| T |
19266414 |
ccttggtgcaac-ggtaaagttgttgtcatgtgactgaaaggtcgtgggttcaagtcctgaaaatagccacttgcgta-aaaaacagggtaaggctgcgt |
19266511 |
T |
 |
| Q |
295 |
acaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctt |
347 |
Q |
| |
|
|||||||||| ||| |||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
19266512 |
acaatacaccaaattgtgggatcccttcccggaccctgcgtatgcgggagctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 257 - 360
Target Start/End: Original strand, 38604550 - 38604654
Alignment:
| Q |
257 |
gaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt-ggtgcac |
355 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
38604550 |
gaaacagcctcttgtgtaaaaacagggtaaggctgcgtacaatacaccaaatggtgagacccctttccggaccctgcgtatgcgggagctttaagtgcac |
38604649 |
T |
 |
| Q |
356 |
cgggt |
360 |
Q |
| |
|
||||| |
|
|
| T |
38604650 |
cgggt |
38604654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 197 - 350
Target Start/End: Complemental strand, 48123655 - 48123502
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaa-aacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||| ||| || |||| ||||||||||||| ||||||||||||||| ||| |||||||||| |||| || |
|
|
| T |
48123655 |
ccttggcgcaac-ggtaaagttgttatcatgtgtctgaaaggtcatgggttcaagtcctggaaacagcctcttgtgtaaataacagggtaaaactgcata |
48123557 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttgg |
350 |
Q |
| |
|
||||||||| |||||||||||||||| | ||||| ||| |||||||||| ||||| |
|
|
| T |
48123556 |
caatacaccaaatggtgggacccctttctggaccatgcatatgcgggaggtttgg |
48123502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 220 - 366
Target Start/End: Original strand, 18747472 - 18747620
Alignment:
| Q |
220 |
ttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa--cagggtaaggctgcgtacaatacaccgaatggtgggacc |
317 |
Q |
| |
|
|||||| ||||||| || |||||||| ||||||| | |||||||||| |||| ||||| ||||||||||||||||| |||||||| | |||||||||| |
|
|
| T |
18747472 |
ttgtcacgtgactgaaaggtcacgggatcaagtcttggaaacagccttttgtgtaaaaaagcagggtaaggctgcgtataatacaccaattggtgggacc |
18747571 |
T |
 |
| Q |
318 |
ccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| | | |||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
18747572 |
ccttcctgaaccctgcgtatgcgggagctttagtgcaccgggctgccct |
18747620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 285 - 366
Target Start/End: Complemental strand, 27889399 - 27889318
Alignment:
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27889399 |
aaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttggtacaccgggttgccct |
27889318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 189 - 354
Target Start/End: Complemental strand, 8149126 - 8148960
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||| || |||||| ||||||||||| |||| ||||| ||| ||||| ||||||| |
|
|
| T |
8149126 |
aggggtaaccttggcacaactggtaatgttgttgtcatgtgactgcaaagtcacgagttcaagtcctgaaaactacctcttgtgttaaaaaatagggtaa |
8149027 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgca |
354 |
Q |
| |
|
|| ||||||||||||||| |||||||||||||||| || || | |||||||||| ||| ||| ||||| |
|
|
| T |
8149026 |
ggttgcgtacaatacaccaaatggtgggaccccttcccaga-cttgcgtatgcgagagttttagtgca |
8148960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 69; E-Value: 7e-31
Query Start/End: Original strand, 238 - 366
Target Start/End: Complemental strand, 31591238 - 31591111
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
337 |
Q |
| |
|
|||||| ||||||||||| |||||| |||||||| | ||||||| |||||||||||||||||||| |||||||||||||||| ||||||| ||| ||| |
|
|
| T |
31591238 |
gtcacgagttcaagtcctggaaacaacctcttgt-gtaaaacagagtaaggctgcgtacaatacaataaatggtgggaccccttcccggaccttgcatat |
31591140 |
T |
 |
| Q |
338 |
gcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| | ||||||||||||||||| |
|
|
| T |
31591139 |
gcgggagctctagtgcaccgggttgccct |
31591111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 211 - 366
Target Start/End: Original strand, 6736867 - 6737020
Alignment:
| Q |
211 |
gtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatgg |
310 |
Q |
| |
|
||||||||||||||||| ||||| || ||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |||| ||||||||||| ||||| |
|
|
| T |
6736867 |
gtaaagttgttgtcatgcgactgaaaggtcacgggttcaagtcctcaaaacaacctcttgtataaaaacaaggtaagactgcatacaatacaccaaatgg |
6736966 |
T |
 |
| Q |
311 |
tgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| ||| || || ||||||| |||||| | ||| |||| |||||||||| |||||| |
|
|
| T |
6736967 |
t-ggagcctttcccggaccttgcgtacgaaggaccttt-gtgcaccgggctgccct |
6737020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 188 - 271
Target Start/End: Original strand, 7193039 - 7193122
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| || ||||||||||||||||||||||||| |||||||| |
|
|
| T |
7193039 |
gaggggtaaccttggcgtaacttgtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctcgaaacaacctcttgt |
7193122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 210 - 344
Target Start/End: Complemental strand, 14099165 - 14099030
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||||||||||||||||||||| || |||| ||||| ||||||| |||| ||||| |||| ||||| |||| |||| |||||||||||||||| ||| |
|
|
| T |
14099165 |
ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaat |
14099066 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggag |
344 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||| |||| |
|
|
| T |
14099065 |
ggtgggaccccttcccgaaccctacgtatgcaggag |
14099030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 210 - 344
Target Start/End: Complemental strand, 14409182 - 14409047
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
|||||||||||||||||||||||| || |||| ||||| ||||||| |||| ||||| |||| ||||| |||| |||| |||||||||||||||| ||| |
|
|
| T |
14409182 |
ggtaaagttgttgtcatgtgactgaaaggtcatgggttgaagtcctggaaatagccttttgtgtaaaaaacaggttaagactgcgtacaatacaccaaat |
14409083 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggag |
344 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||| |||| |
|
|
| T |
14409082 |
ggtgggaccccttcccgaaccctacgtatgcaggag |
14409047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 259 - 366
Target Start/End: Complemental strand, 35787378 - 35787271
Alignment:
| Q |
259 |
aacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||||||||||||| ||||||| ||||||| ||||||||||||||| ||||| |||||||||| ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
35787378 |
aacagcctcttgtgtaaaaacatggtaaggttgcgtacaatacaccaaatggcgggaccccttcccggaccttgcgtatgcgggagcttcaatgcaccgg |
35787279 |
T |
 |
| Q |
359 |
gttgccct |
366 |
Q |
| |
|
|||||||| |
|
|
| T |
35787278 |
gttgccct |
35787271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 210 - 366
Target Start/End: Original strand, 16341254 - 16341412
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaatacacc-gaa |
307 |
Q |
| |
|
|||||||||||| |||||| || || ||||||||||||||| || ||||||||||||||| ||||||||||||||||| ||||||||||||| || |
|
|
| T |
16341254 |
ggtaaagttgttatcatgtatttgaaaggtcacgggttcaagttctagaaacagcctcttgtgtaaaaaacagggtaaggctacgtacaatacaccaaaa |
16341353 |
T |
 |
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| || ||| ||||||| | ||||||||||||||||||||||||| |||||| |
|
|
| T |
16341354 |
tggtgggccctcttcccggacctatcatatgcgggagctttggtgcaccgggctgccct |
16341412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 225 - 366
Target Start/End: Complemental strand, 38262340 - 38262198
Alignment:
| Q |
225 |
atgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgtacaatacaccgaatggtgggaccccttgc |
323 |
Q |
| |
|
||||||||| || |||||||||||||||||| ||||||| ||||||| ||||| | ||||| | ||| ||||||||||| |||| ||||||||||| | |
|
|
| T |
38262340 |
atgtgactggaaggtcacgggttcaagtcctggaaacagtctcttgtgtaaaaaatatggtaatgttgcatacaatacaccaaatgatgggaccccttcc |
38262241 |
T |
 |
| Q |
324 |
cggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| || ||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
38262240 |
cgaacactgcgtatgcgggagctttagtgcaccggattgccct |
38262198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 197 - 366
Target Start/End: Complemental strand, 3469350 - 3469177
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt---agaaaaacagggtaaggctgcg |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| || ||||| | ||||||||| |||||| ||||||| | |||||||||||| || |||| |
|
|
| T |
3469350 |
ccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacagactcaagtcctagaaacattctcttgtgtaaaaaaaacagggtacggttgcg |
3469252 |
T |
 |
| Q |
294 |
tacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| ||||| |||||||||| | ||||||| ||||||||||||||| |||| | |||||||||| |
|
|
| T |
3469251 |
tacaatacaccaaaaatggcgggaccccttcctagaccctgtgtatgcgggagctttagtgcgctgggttgccct |
3469177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 189 - 304
Target Start/End: Complemental strand, 5180337 - 5180221
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaag |
287 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| || |||| |||||||| | || ||||||||||||||| |||||||||||||| |
|
|
| T |
5180337 |
aggggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcaagggttcaacttctggaaacagcctcttgtgtcaaaaacagggtaag |
5180238 |
T |
 |
| Q |
288 |
gctgcgtacaatacacc |
304 |
Q |
| |
|
||| |||||| ||||| |
|
|
| T |
5180237 |
actgtgtacaacacacc |
5180221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 193 - 290
Target Start/End: Complemental strand, 7794682 - 7794582
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt---agaaaaacagggtaaggc |
289 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||| || |||||||||||||||||| ||||||||||||| | | |||||||||||||||| |
|
|
| T |
7794682 |
gtaaccttagcgcaactggtaaagttgttgttatgtgactggaaggtcacgggttcaagtcctggaaacagcctcttatgtaaaaaaaacagggtaaggc |
7794583 |
T |
 |
| Q |
290 |
t |
290 |
Q |
| |
|
| |
|
|
| T |
7794582 |
t |
7794582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 187 - 304
Target Start/End: Original strand, 12473257 - 12473375
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| ||| || |||| ||||||||||||| ||||| |||||||| |||||||||||| |
|
|
| T |
12473257 |
tgaggggtagccttggcgcaaccggtaaagttgttgtcatgtatctgaaaggtcatgggttcaagtcctgcaaacaacctcttgtgtcaaaaacagggta |
12473356 |
T |
 |
| Q |
286 |
aggctgcgtacaatacacc |
304 |
Q |
| |
|
||| ||||||||||||||| |
|
|
| T |
12473357 |
aggatgcgtacaatacacc |
12473375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 217 - 366
Target Start/End: Complemental strand, 32233286 - 32233137
Alignment:
| Q |
217 |
ttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggac |
316 |
Q |
| |
|
||||||||| |||||| || |||| ||||||||||||| |||||| |||||||| |||||||||||||||| ||||| | |||||| |||||||||| |
|
|
| T |
32233286 |
ttgttgtcacctgactgaaaggtcatgggttcaagtcctggaaacaacctcttgtgtaaaaacagggtaaggcagcgtatattacaccaaatggtgggat |
32233187 |
T |
 |
| Q |
317 |
cccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| || ||||||| |||| |||||||| |||||||||| |||||| |
|
|
| T |
32233186 |
tccttcccaaaccctgcatatgagggagcttcagtgcaccgggctgccct |
32233137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 209 - 343
Target Start/End: Original strand, 7644931 - 7645066
Alignment:
| Q |
209 |
tggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaatacacc-ga |
306 |
Q |
| |
|
||||||| ||||||| | ||||||| || |||||||||||||||||| ||||||||||||||| |||||||||||||| |||||||||||||| | |
|
|
| T |
7644931 |
tggtaaatttgttgtaacgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaaaaaacagggtaagatagcgtacaatacaccaaa |
7645030 |
T |
 |
| Q |
307 |
atggtgggaccccttgccggaccctgcgtatgcggga |
343 |
Q |
| |
|
|| |||||||||||| || |||||||||||||||||| |
|
|
| T |
7645031 |
attgtgggacccctt-cctgaccctgcgtatgcggga |
7645066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 250 - 366
Target Start/End: Original strand, 23231573 - 23231690
Alignment:
| Q |
250 |
agtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||| |||| |||||||||| |||| | | |||||||||||||| ||||||||||||| ||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
23231573 |
agtcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagcttt |
23231672 |
T |
 |
| Q |
349 |
ggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| ||| |||| |
|
|
| T |
23231673 |
agtgcaccgagtttccct |
23231690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 246 - 364
Target Start/End: Original strand, 1408469 - 1408588
Alignment:
| Q |
246 |
ttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggag |
344 |
Q |
| |
|
|||||||||| |||| |||||||||| ||||| || |||||||||| |||||||||| | |||||||||||||||| ||||||||||||||||| | | |
|
|
| T |
1408469 |
ttcaagtcctggaaatagcctcttgtgtaaaaaacaaggtaaggctgtgtacaatacagcaaatggtgggaccccttcccggaccctgcgtatgcagaat |
1408568 |
T |
 |
| Q |
345 |
ctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||| || |||||| ||||| |
|
|
| T |
1408569 |
ctttagttcaccggattgcc |
1408588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 197 - 353
Target Start/End: Complemental strand, 42102056 - 42101899
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggtaaggctgcgt |
294 |
Q |
| |
|
||||||| |||| |||||||||||||||| ||||||| || |||| ||||||||||| ||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
42102056 |
ccttggcacaac-ggtaaagttgttgtcacgtgactggaaggtcaaaagttcaagtcctggaaacagcctcttccgta-aaaaacagggtaacactgcgt |
42101959 |
T |
 |
| Q |
295 |
acaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgc |
353 |
Q |
| |
|
||| ||| | || ||||||||||| || ||||||||||||||| ||| |||||| |||| |
|
|
| T |
42101958 |
acagtactctaaagtggtgggaccctttcccggaccctgcgtatccggcagctttagtgc |
42101899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 194 - 304
Target Start/End: Complemental strand, 1424085 - 1423974
Alignment:
| Q |
194 |
taaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgc |
292 |
Q |
| |
|
|||| ||||||||||||||||||||||||| ||||||||| || ||||||| ||||| |||| ||||||| || |||| ||||||||||||| ||||| |
|
|
| T |
1424085 |
taactttggcgcaactggtaaagttgttgttatgtgactggaaggtcacggattcaaatcctggaaacagtctgttgtgtaaaaaacagggtaatgctgc |
1423986 |
T |
 |
| Q |
293 |
gtacaatacacc |
304 |
Q |
| |
|
|||| |||||| |
|
|
| T |
1423985 |
atacactacacc |
1423974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 238 - 359
Target Start/End: Original strand, 21566439 - 21566562
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgt |
335 |
Q |
| |
|
||||| |||||||||| | ||||| ||||||||| ||||| ||| | ||| |||||||||||||||| || |||| ||||||||| ||| ||||||| | |
|
|
| T |
21566439 |
gtcacaggttcaagtcttggaaaccgcctcttgtgtaaaaaacagaggaagactgcgtacaatacaccaaaatggtaggaccccttcccgaaccctgcat |
21566538 |
T |
 |
| Q |
336 |
atgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||||||||||||| |||||||||| |
|
|
| T |
21566539 |
atgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 197 - 348
Target Start/End: Complemental strand, 44123792 - 44123642
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
|||||| ||||| |||||||||| ||||||||||||| || | |||||||||||| || ||||||||||||||| ||||||| ||||||| ||| | |
|
|
| T |
44123792 |
ccttggtgcaac-ggtaaagttggtgtcatgtgactgaaagattacgggttcaagtactggaaacagcctcttgtgtaaaaacaaggtaaggttgcatga |
44123694 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||||| || |||||||| || ||||| |||||||||| |||||||| |
|
|
| T |
44123693 |
aatacaccatataatgggacccgttctcggacactgcgtatgcaggagcttt |
44123642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 191 - 363
Target Start/End: Original strand, 25198679 - 25198856
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttc---aagtcctcgaaacagcctct--tgtagaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |||||| || ||| ||| || ||||| | ||||||| || | |||| ||||||| |||| |
|
|
| T |
25198679 |
gggtaaccttggcgtaactggtaaagttgttgtcatatgactgaaagatcatgggatcaaaaagtcttggaaacagtcttttgtgtaaaaaaacaaggta |
25198778 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgc |
363 |
Q |
| |
|
|| | ||||| ||| ||| |||||| ||| ||||| || |||||| |||||| | ||||||| |||||||||||||| |
|
|
| T |
25198779 |
agaccgcgtataatgcactaaatggtaggatcccttcccagacccttcgtatgtgagagctttagtgcaccgggttgc |
25198856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 285 - 366
Target Start/End: Complemental strand, 45019010 - 45018925
Alignment:
| Q |
285 |
aaggctgcgtacaatacaccgaa----tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| ||| || |||||| ||||||| |||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
45019010 |
aaggctgcgtacaatataccaaaaaactggtggaaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccct |
45018925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 188 - 271
Target Start/End: Original strand, 21447544 - 21447627
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||| | || || ||||||| |||||||| | |||||||||||||| |
|
|
| T |
21447544 |
gaggggtaaccttggcgcaactgataaatttgttgtcatgtaattggaaggtcacggattcaagtcttgaaaacagcctcttgt |
21447627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 274 - 366
Target Start/End: Complemental strand, 23066019 - 23065927
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| ||| | ||||||||||||||| ||| ||||| ||||| ||| | ||||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
23066019 |
aaaaacaggataaagttgcgtacaatacaccatatgatgggatccctttccgaatcctgcatatgtgggagctttggtgcaccggattgccct |
23065927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 276 - 343
Target Start/End: Original strand, 33500556 - 33500625
Alignment:
| Q |
276 |
aaacagggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcggga |
343 |
Q |
| |
|
|||||||||||| |||||||| |||||| || |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33500556 |
aaacagggtaagactgcgtactatacacaaaaaatggtgggaccccttcccggaccctgcgtatgcggga |
33500625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 366
Target Start/End: Original strand, 22065563 - 22065720
Alignment:
| Q |
209 |
tggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaat |
308 |
Q |
| |
|
||||||||||||||||| |||| || || |||| | |||||||| | |||||| |||||||| ||||| ||||||| ||||| ||||||| | | ||| |
|
|
| T |
22065563 |
tggtaaagttgttgtcacgtgattgaaaagtcatgagttcaagttttggaaacaacctcttgtgtaaaaatagggtaaagctgcatacaataaagcaaat |
22065662 |
T |
 |
| Q |
309 |
ggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| |||||||| ||| || || |||||| |||| ||| ||| |||||| |||||| |
|
|
| T |
22065663 |
agtgagaccccttcccgaactatgtgtatgcaggagttttagtgtaccgggctgccct |
22065720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 286 - 358
Target Start/End: Complemental strand, 36267900 - 36267827
Alignment:
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccc-cttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
||||||||||||||||||| |||||| |||||| || ||| |||||| ||||||||||||||| ||||||||| |
|
|
| T |
36267900 |
aggctgcgtacaatacaccaaatggttggacccatttcccgaaccctgtgtatgcgggagctttagtgcaccgg |
36267827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 238 - 338
Target Start/End: Complemental strand, 15108527 - 15108427
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
337 |
Q |
| |
|
|||||| ||||||||||| ||||||| |||||| ||||||| |||||||||| |||||||||| | ||| |||||| ||||| || |||||| |||| |
|
|
| T |
15108527 |
gtcacgagttcaagtcctggaaacagtttcttgtgtaaaaacaaggtaaggctgtgtacaatacatcaaatagtgggatcccttcccaaaccctgtgtat |
15108428 |
T |
 |
| Q |
338 |
g |
338 |
Q |
| |
|
| |
|
|
| T |
15108427 |
g |
15108427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 326 - 366
Target Start/End: Original strand, 36602540 - 36602580
Alignment:
| Q |
326 |
gaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36602540 |
gaccctgcgtatgcgggagctttagtgcaccgggttgccct |
36602580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 275 - 366
Target Start/End: Complemental strand, 23619070 - 23618979
Alignment:
| Q |
275 |
aaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| ||||| || |||||||||| | |||||||||||||||| | |||| ||||| ||| |||||||| ||||| ||||||||||| |
|
|
| T |
23619070 |
aaaacagagtaagcttgtgtacaatacatcaaatggtgggaccccttcgcagaccttgcgtttgcaggagctttagtgcagcgggttgccct |
23618979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 191 - 242
Target Start/End: Complemental strand, 29140538 - 29140487
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcac |
242 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||| || ||||| |
|
|
| T |
29140538 |
gggtaatcttggcgcaactggtaaagttgttgtcatgtaactgaaaggtcac |
29140487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 261 - 366
Target Start/End: Complemental strand, 13792257 - 13792152
Alignment:
| Q |
261 |
cagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccggg |
359 |
Q |
| |
|
||||||| |||| |||||| |||||| |||| ||||||||||| || ||| |||||||||| || ||||||||||||| |||||||| |||||||| | |
|
|
| T |
13792257 |
cagcctcgtgta-aaaaacttggtaagactgcatacaatacacccaaatggcgggaccccttctcgaaccctgcgtatgctggagcttttgtgcaccgag |
13792159 |
T |
 |
| Q |
360 |
ttgccct |
366 |
Q |
| |
|
|||||| |
|
|
| T |
13792158 |
ctgccct |
13792152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 265 - 355
Target Start/End: Complemental strand, 21139851 - 21139761
Alignment:
| Q |
265 |
ctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
||||||| |||||||| |||||| || |||| |||||| |||||||||||||||| ||| || ||| |||||||| |||||| |||||| |
|
|
| T |
21139851 |
ctcttgtgtaaaaacagagtaaggttggatacagtacaccaaatggtgggaccccttcccgaactctgtgtatgcggaagctttagtgcac |
21139761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 238 - 348
Target Start/End: Original strand, 35203443 - 35203556
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcg |
334 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||| ||||||||| |||| |||||||||||| ||| |||||||||| ||||| | | || || || |
|
|
| T |
35203443 |
gtcacgggttcaagtcctggaaacattctcttgtgtaaaaaacaggataagactgcgtacaatataccaaaaatggtgggatcccttcctgaactctacg |
35203542 |
T |
 |
| Q |
335 |
tatgcgggagcttt |
348 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
35203543 |
tatgcgggagcttt |
35203556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 187 - 252
Target Start/End: Original strand, 5814424 - 5814489
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagt |
252 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||| |||||| || || ||||||||||||||| |
|
|
| T |
5814424 |
tgagaggttaccttggcgcaatcggtaaagttgttgttatgtgattggaaagtcacgggttcaagt |
5814489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 317 - 365
Target Start/End: Complemental strand, 42495913 - 42495865
Alignment:
| Q |
317 |
cccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
42495913 |
cccttcccggaccctgcgtatgcgggagctttagtgcaccccgttgccc |
42495865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 233
Target Start/End: Complemental strand, 45019056 - 45019012
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
45019056 |
aggggtaaccttggcgcaactggtaaaggtcctgtcatgtgactg |
45019012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 276 - 366
Target Start/End: Complemental strand, 39093532 - 39093441
Alignment:
| Q |
276 |
aaacagggtaaggctgcgtacaatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||| ||| |||||||||||| ||| |||||| ||||| ||||| | ||| ||||| | |||||| |||||||||| |||||| |
|
|
| T |
39093532 |
aaacagggtaagactgtgtacaatacaccataatagtgggaacccttcccggaacttgcatatgcagaagctttagtgcaccgggctgccct |
39093441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 310 - 366
Target Start/End: Original strand, 11888414 - 11888470
Alignment:
| Q |
310 |
gtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||| | |||||||| |||||| ||||||| |||||| |||||||||| |
|
|
| T |
11888414 |
gtgggacccctttctggaccctgtgtatgcaggagcttcagtgcactgggttgccct |
11888470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 325 - 357
Target Start/End: Original strand, 25434112 - 25434144
Alignment:
| Q |
325 |
ggaccctgcgtatgcgggagctttggtgcaccg |
357 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
25434112 |
ggaccctgcgtatgcgggagctttagtgcaccg |
25434144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 131; Significance: 7e-68; HSPs: 52)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 1346918 - 1347095
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||| ||||| | ||||||||||||| |
|
|
| T |
1346918 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagccacttgt-gtaaaacagggtaag |
1347016 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
1347017 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
1347095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 1354936 - 1354759
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
1354936 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcactggttcaagtcctggaaacagcctcttgt-gtaaaacagggtaag |
1354838 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
1354837 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
1354759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 29356040 - 29355857
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaag-ttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaa-aaacagggt |
284 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||| || |||||||||||||||||| ||||||||||||||| || ||||||||| |
|
|
| T |
29356040 |
tgaggggtaaccttggcacaactggtaaaaattgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtgtaagaaacagggt |
29355941 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccga--atggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29355940 |
aaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
29355857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 198 - 366
Target Start/End: Complemental strand, 12222088 - 12221916
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||| | ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12222088 |
cttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaacagcctcttgtgtaaaaaacagggtaaggctgcgtac |
12221989 |
T |
 |
| Q |
297 |
aatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagc-tttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12221988 |
aatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttttagtgcaccgggttgccct |
12221916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 187 - 366
Target Start/End: Original strand, 9161076 - 9161257
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaa |
286 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||||||||||||||| || ||||| |||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
9161076 |
tgaggggtaaccttgacgcaatcggtaaagttgttgtcatgtgactgaaaggtcacaggttcaagtcctggaaacagcctcttgtgtaaaaacagagtaa |
9161175 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||| |||||||||||||||||| |||||| ||||||| ||||||||| |
|
|
| T |
9161176 |
ggctgcgtacaatacatcaataatggtgggaccccttctcggaccctgcgtatgcggaagctttagtgcaccaggttgccct |
9161257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 190 - 361
Target Start/End: Complemental strand, 3815256 - 3815084
Alignment:
| Q |
190 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaagg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||| || |||| ||||| | |||| | |
|
|
| T |
3815256 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaatgtcacgggttcaagtcctggaaacagactattgtgtaaaaaatatggtacga |
3815157 |
T |
 |
| Q |
289 |
ctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggtt |
361 |
Q |
| |
|
|||||||||||||||| ||||||||||||| || ||| ||||| ||||||||| |||||| |||||||||||| |
|
|
| T |
3815156 |
ctgcgtacaatacaccaaatggtgggaccctttcccgaaccctacgtatgcggaagctttagtgcaccgggtt |
3815084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 1941809 - 1941988
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaa |
286 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||| || ||| ||| || ||||| | ||||| |||||||| |||| ||||||||| |
|
|
| T |
1941809 |
gaggggtaaccttggtgcaactggtaaagttgttgtcatctgactggaaggtcgcggattgaagtcatgtaaacaacctcttgtgtaaaaaacagggtaa |
1941908 |
T |
 |
| Q |
287 |
ggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | | ||| | || ||||||||||| ||| |||||||| |||||||| |
|
|
| T |
1941909 |
ggctgcgtacaatacaccgaatggtgggaccccatcctggatcttgtgtatgcgggagtttttgtgcaccgtgttgccct |
1941988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 188 - 366
Target Start/End: Complemental strand, 15866218 - 15866041
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggta |
285 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| ||||||| || || |||| |||||||| |||| ||||||||||||| ||| |||||||||||| |
|
|
| T |
15866218 |
gaggggtaaccttggcccaactggtaaagttgttggcatgtgattgaaaggtcatgggttcaattcctggaaacagcctcttaagta-aaaaacagggta |
15866120 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| ||||||| |||||||| |||||||||||||||| ||||||||||||| ||||||| || | |||||| | |||||||| |
|
|
| T |
15866119 |
aagctgcgt--aatacaccaaatggtgggaccccttcccggaccctgcgtttgcgggatctatagtgcactgagttgccct |
15866041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 193 - 366
Target Start/End: Complemental strand, 2166587 - 2166412
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctg |
291 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| ||||||||| || |||||||||||||||||| |||||| |||||||| |||| ||||| ||||| || |
|
|
| T |
2166587 |
gtaaccttg-cgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttg |
2166489 |
T |
 |
| Q |
292 |
cgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
2166488 |
cgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccct |
2166412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 193 - 366
Target Start/End: Complemental strand, 2178220 - 2178045
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctg |
291 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| ||||||||| || |||||||||||||||||| |||||| |||||||| |||| ||||| ||||| || |
|
|
| T |
2178220 |
gtaaccttg-cgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttg |
2178122 |
T |
 |
| Q |
292 |
cgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
2178121 |
cgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccct |
2178045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 187 - 301
Target Start/End: Original strand, 8409196 - 8409311
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||| |||||||||| ||||| ||||||||| |||||||||||| |
|
|
| T |
8409196 |
tgaggggtaaccttggcgcaactggtaaagttgttgtaatgtgactgaaaggtcacggattcaagtcctggaaactgcctcttgtgtaaaaaacagggta |
8409295 |
T |
 |
| Q |
286 |
aggctgcgtacaatac |
301 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8409296 |
aggctgcgtacaatac |
8409311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 198 - 366
Target Start/End: Original strand, 24097545 - 24097710
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgta-gaaaaacagggtaaggctgcgtac |
296 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||| |||| || |||||| ||| ||||||||||| |||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
24097545 |
cttggcacaactggtaaaattgatgtcatgttactgaaaggtcacgagtttaagtcctcgaaccagcctcttgtataaaaaacagggtaaggctgcttac |
24097644 |
T |
 |
| Q |
297 |
aatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| ||| |||||||||||||||| ||||||||||||||||||| |||||| ||| || ||||||||| |
|
|
| T |
24097645 |
a----accaaatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgtcccaggttgccct |
24097710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 252 - 366
Target Start/End: Original strand, 26097178 - 26097291
Alignment:
| Q |
252 |
tcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggt |
351 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||| |||||||||||| | || |
|
|
| T |
26097178 |
tcctggaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatgaagggaccccttcccggaccctgcatatgcgggagctctagt |
26097276 |
T |
 |
| Q |
352 |
gcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
26097277 |
gcaccgggttgccct |
26097291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 252 - 366
Target Start/End: Original strand, 25557743 - 25557856
Alignment:
| Q |
252 |
tcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggt |
351 |
Q |
| |
|
|||| ||||||||||||||| | |||||||||||||||||||||||||||||| |||| || ||||||| ||||||||||| |||||||||||| | || |
|
|
| T |
25557743 |
tcctggaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatgaaggaaccccttcccggaccctgcatatgcgggagctctagt |
25557841 |
T |
 |
| Q |
352 |
gcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
25557842 |
gcaccgggttgccct |
25557856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 189 - 365
Target Start/End: Complemental strand, 13905158 - 13904984
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaag |
287 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||| || |||||||| ||||||||| |||| |||||||| |||||||||||||| |
|
|
| T |
13905158 |
agggggaaccttggcgcaac-ggtaaagttgttgtcatgtgactgaaaggtcacgggctcaagtcctgaaaacgacctcttgtgtaaaaaacagggtaag |
13905060 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccc |
365 |
Q |
| |
|
||||| |||||| |||| |||||| |||||| || ||| ||||||||||| |||||||| |||||||||| ||||| |
|
|
| T |
13905059 |
gctgcatacaattcaccaaatggt-ggaccctttcccgaaccctgcgtatcacggagcttt-gtgcaccgggctgccc |
13904984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 239 - 357
Target Start/End: Original strand, 33138838 - 33138957
Alignment:
| Q |
239 |
tcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtat |
337 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| ||||| ||| ||||||| |||||||||||||| ||||||||||||| || |||||||||| |||| |
|
|
| T |
33138838 |
tcacgggttcaagtcctggaaacaacctcttgtataaaaaacagagtaaggccgcgtacaatacaccaaatggtgggacccttttccggaccctgtgtat |
33138937 |
T |
 |
| Q |
338 |
gcgggagctttggtgcaccg |
357 |
Q |
| |
|
|| | |||||| |||||||| |
|
|
| T |
33138938 |
gcagtagctttagtgcaccg |
33138957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 197 - 355
Target Start/End: Complemental strand, 7947543 - 7947384
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||| || ||||| ||||||| |||| |||||| |||| ||| |||||| |||||||||||||||| |
|
|
| T |
7947543 |
ccttggcgcaac-ggtaaagttggtgttgcgtgactgaaaggtcaccggttcaactcctggaaacaacctcctgtgtaaaaaccagggtaaggctgcgta |
7947445 |
T |
 |
| Q |
296 |
caatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcac |
355 |
Q |
| |
|
||||||||| ||||||||| |||||| ||||||| |||||||| ||||||||| |||||| |
|
|
| T |
7947444 |
caatacaccaaaatggtgggcccccttcccggaccttgcgtatgtgggagctttagtgcac |
7947384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 187 - 271
Target Start/End: Complemental strand, 14975262 - 14975178
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt |
271 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| || ||||||| |||||||||| ||||||||||||||| |
|
|
| T |
14975262 |
tgagggataaccttggcgcaaccggtaaagttgttgtcatgtgactggaaggtcacggattcaagtcctggaaacagcctcttgt |
14975178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 244 - 348
Target Start/End: Original strand, 32579436 - 32579540
Alignment:
| Q |
244 |
ggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcggga |
343 |
Q |
| |
|
|||||||||||| |||||||||||| ||| ||||| | |||||| ||||||||||||| || |||||||||||||||| || |||||||| ||||||||| |
|
|
| T |
32579436 |
ggttcaagtcctggaaacagcctctggtataaaaatacggtaagcctgcgtacaataccccaaatggtgggaccccttcccagaccctgcatatgcggga |
32579535 |
T |
 |
| Q |
344 |
gcttt |
348 |
Q |
| |
|
||||| |
|
|
| T |
32579536 |
gcttt |
32579540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 188 - 330
Target Start/End: Original strand, 6024187 - 6024332
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaa |
286 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||||||||| || || ||||||| ||||| |||| ||||||||||||||| ||||||| ||||| |
|
|
| T |
6024187 |
gaggggtaattttgacgcaactggtaaagttgttgtcatgtgattggaaggtcacggtttcaaatcctagaaacagcctcttgtgtaaaaaacatggtaa |
6024286 |
T |
 |
| Q |
287 |
ggctgcgtacaatacacc--gaatggtgggaccccttgccggaccc |
330 |
Q |
| |
|
| |||||||||||||||| |||| ||||||| ||| |||||||| |
|
|
| T |
6024287 |
gactgcgtacaatacaccaataatgatgggacctcttcccggaccc |
6024332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 220 - 366
Target Start/End: Complemental strand, 23240971 - 23240826
Alignment:
| Q |
220 |
ttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggacccc |
319 |
Q |
| |
|
|||||| ||||||| || ||||| ||| |||||||| ||||||||||||||| | ||||||||||||| ||||||||||| ||| | |||||||||||| |
|
|
| T |
23240971 |
ttgtcacgtgactgaaaggtcacaggtgcaagtcctggaaacagcctcttgt-gtaaaacagggtaagtttgcgtacaatataccaattggtgggacccc |
23240873 |
T |
 |
| Q |
320 |
ttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|| |||| |||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
23240872 |
ttctaggacaatgcgtatgcgggagctttagtgcactgggctgccct |
23240826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 186 - 344
Target Start/End: Original strand, 22967123 - 22967287
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||||| ||||||||||||||||| ||||| ||||||||| | |||||| | |||||| ||||| ||| || |
|
|
| T |
22967123 |
ttgaggggtaaccttcgcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgtaaaaataggata |
22967222 |
T |
 |
| Q |
286 |
aggctgc------gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggag |
344 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
22967223 |
aggctgcatacaaatacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag |
22967287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 186 - 344
Target Start/End: Complemental strand, 23821270 - 23821106
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggta |
285 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||||| ||||||||||||||||| ||||| ||||||||| | |||||| | |||||| ||||| ||| || |
|
|
| T |
23821270 |
ttgaggggtaaccttcgcgcatctgataaagttattgtcatgtgactgtaaggtcactagttcaagtcatggaaacaacttcttgtgtaaaaataggata |
23821171 |
T |
 |
| Q |
286 |
aggctgc------gtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggag |
344 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
23821170 |
aggctgcatacaaatacaatacaccaaatggtgggaccccttcttggaccctgcctatgcgggag |
23821106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 179 - 357
Target Start/End: Original strand, 20400612 - 20400791
Alignment:
| Q |
179 |
attttcattgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaa |
277 |
Q |
| |
|
||||| || ||| |||||||||||||||| ||||| ||||||||||||||||||| || ||||| ||||||||| | |||||| ||||||| |||| |
|
|
| T |
20400612 |
atttttatagagaggtaaccttggcgcaattggtatagttgttgtcatgtgactgaaaggtcacaggttcaagttatggaaacaatctcttgtgtaaaaa |
20400711 |
T |
 |
| Q |
278 |
acagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccg |
357 |
Q |
| |
|
|||||||||| ||||||||| ||||| ||| | ||||||| || ||| ||||| ||||||| | | |||| |||||||| |
|
|
| T |
20400712 |
acagggtaagactgcgtacagtacactaaatagcgggacccttttccgaaccctacgtatgcagaaactttagtgcaccg |
20400791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 212 - 321
Target Start/End: Original strand, 28007604 - 28007714
Alignment:
| Q |
212 |
taaagttgttgtcatgtgac-tg-taacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatg |
309 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||| |||| |||||||||| | |||||||||| ||||||||||||||||||| |||| |
|
|
| T |
28007604 |
taaagttgttgtcatgtgacatgaaaaggtcacgggttcaagtcctggaaagagcctcttgt-gtaaaacagggtcaggctgcgtacaatacaccaaatg |
28007702 |
T |
 |
| Q |
310 |
gtgggacccctt |
321 |
Q |
| |
|
||||||||||| |
|
|
| T |
28007703 |
ctgggacccctt |
28007714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 192 - 366
Target Start/End: Complemental strand, 23930303 - 23930129
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttc-aagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggc |
289 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||| || || |||||| |||| ||||| | ||||||| ||| ||| ||||| || | || | |
|
|
| T |
23930303 |
ggtaaccttggcgcaactcataaagatgttgtcatgtgtctcaaaggtcacgagttccaagtcatggaaacagtctcatgtgtaaaaaacaagata--gt |
23930206 |
T |
 |
| Q |
290 |
tgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||| |||||||| |||||||| |
|
|
| T |
23930205 |
tgcgtacaatacaccagatggtgggaccccttcacggaccctgcttatgcgggagctttagtgcaccgagttgccct |
23930129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 219 - 362
Target Start/End: Complemental strand, 18277343 - 18277199
Alignment:
| Q |
219 |
gttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaatggtgggacc |
317 |
Q |
| |
|
|||||| ||||||| || ||||||||||||| || | ||||||||||||||| ||||| |||||||||| || ||||| ||||| |||||||||||| |
|
|
| T |
18277343 |
gttgtcctgtgactaaaaggtcacgggttcaaatcttggaaacagcctcttgtgtaaaaatcagggtaaggttgagtacagaacaccaaatggtgggacc |
18277244 |
T |
 |
| Q |
318 |
ccttgccggaccctgcgtatgcgggagctttggtgcaccgggttg |
362 |
Q |
| |
|
|||| | ||| || |||||||||||||||| |||||||||||| |
|
|
| T |
18277243 |
ccttcctagactctacgtatgcgggagctttactgcaccgggttg |
18277199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 191 - 278
Target Start/End: Original strand, 12063424 - 12063511
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa |
278 |
Q |
| |
|
|||||||||||| ||||||| |||||||||| ||||| ||||| || |||||||||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
12063424 |
gggtaaccttggtgcaactgataaagttgttatcatgagactgaaaggtcacgggttcaagtcctagaaatagcctcttgtataaaaa |
12063511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 197 - 366
Target Start/End: Original strand, 12889390 - 12889560
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
||||||| |||| |||||||||||||||| |||| || || ||||| |||||||||| | |||||||||||||| |||||||||| |||||||| || |
|
|
| T |
12889390 |
ccttggcacaac-ggtaaagttgttgtcacgtgagtgaaaggtcacaggttcaagtcttgaaaacagcctcttgtgttaaaaacagggcaaggctgcata |
12889488 |
T |
 |
| Q |
296 |
caatacacc-gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| || | ||||||||||| ||||||||| || || ||||||||| ||||| |||| |||||| |
|
|
| T |
12889489 |
caatacacctaaacgatgggacccctttccggaccctctgtgtgtgggagctttagtgcatcgggctgccct |
12889560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 199 - 346
Target Start/End: Original strand, 14553477 - 14553626
Alignment:
| Q |
199 |
ttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt-agaaaaacagggtaaggctgcgtaca |
297 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| || ||||| |||||||||||| |||| ||| |||||| ||||| |||||||||||| ||| | |
|
|
| T |
14553477 |
ttggtgcaactggtaaagttgttgtcatgtgact-aaaggtcacaggttcaagtcctggaaatagcttcttgtgtaaaaaatagggtaaggctgtgtata |
14553575 |
T |
 |
| Q |
298 |
atacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagct |
346 |
Q |
| |
|
||||||| || |||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
14553576 |
atacaccaaaactggtgggaccccttcgtagaccctgtgtatgcgggagct |
14553626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 192 - 341
Target Start/End: Original strand, 24734591 - 24734752
Alignment:
| Q |
192 |
ggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgt----------agaaaaacag |
281 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||| || |||| |||||| |||| |||||| |||||||| | |||||||| |
|
|
| T |
24734591 |
ggtaacattggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaaaagttcaaatccttgaaacaacctcttgtgtaaaaaaaaaaaaaaacag |
24734690 |
T |
 |
| Q |
282 |
ggtaaggctgcgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgg |
341 |
Q |
| |
|
||||||| ||||||||||||| | || ||||||||||||| ||||| ||||||||||||| |
|
|
| T |
24734691 |
ggtaaggttgcgtacaatacaacaaaaaaggtgggaccccttcccggatcctgcgtatgcgg |
24734752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 296 - 366
Target Start/End: Original strand, 13267788 - 13267858
Alignment:
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| |||||||||||||||| | ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13267788 |
caatacaccaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgccct |
13267858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 188 - 270
Target Start/End: Complemental strand, 33923009 - 33922927
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttg |
270 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||| || ||||| |||||||||||| ||||| ||||||| |
|
|
| T |
33923009 |
gaggggtaaccttggcgcaaccggtaaagttgttgtcatttgactgaaaagtcacaggttcaagtcctagaaacgtcctcttg |
33922927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 306 - 366
Target Start/End: Original strand, 6808468 - 6808528
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
6808468 |
aatggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgccct |
6808528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 238 - 366
Target Start/End: Complemental strand, 15865987 - 15865859
Alignment:
| Q |
238 |
gtcacgggttcaagtcctcgaaacagcctctt--gtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgt |
335 |
Q |
| |
|
|||| |||||||| |||| ||||||||||||| ||| ||||||||||||| |||||||| ||||||| |||||||||||||||| | ||||||||||| |
|
|
| T |
15865987 |
gtcatgggttcaattcctggaaacagcctcttacgtaaaaaaacagggtaaagctgcgta--atacaccaaatggtgggaccccttcctggaccctgcgt |
15865890 |
T |
 |
| Q |
336 |
atgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| || || | |||||| | |||||||| |
|
|
| T |
15865889 |
ttgcgtgatctatagtgcactgagttgccct |
15865859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 191 - 366
Target Start/End: Complemental strand, 32728334 - 32728159
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctct--tgtagaaaaacagggtaagg |
288 |
Q |
| |
|
|||||||||||| | ||| ||||||||||||||||||||||| || ||||| | ||||||| | |||||| ||||| |||| |||||||||||||| |
|
|
| T |
32728334 |
gggtaaccttggtggaacgagtaaagttgttgtcatgtgactgaaaggtcacagattcaagttttggaaacaacctcttatgta-aaaaacagggtaaga |
32728236 |
T |
 |
| Q |
289 |
ctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||| |||||||| ||| ||| || || ||| || || |||||| ||||||||||| |||| ||||||| |||||||| |
|
|
| T |
32728235 |
ctgtgtacaatataccaaatagt-ggtccctttcccagaccctacgtatgcgggaactttagtgcaccatgttgccct |
32728159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 306 - 366
Target Start/End: Original strand, 12885986 - 12886046
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
12885986 |
aatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccct |
12886046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 306 - 366
Target Start/End: Original strand, 12892082 - 12892142
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
12892082 |
aatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
12892142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 291 - 366
Target Start/End: Complemental strand, 383837 - 383762
Alignment:
| Q |
291 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| | |||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
383837 |
gcgtacaatacaccaaattgtgggaccccttctcagaccctgcgtatgcgggagcttcagtccaccgggttgccct |
383762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 200 - 366
Target Start/End: Complemental strand, 3116299 - 3116131
Alignment:
| Q |
200 |
tggcgcaactggtaaagttgttgtcatgtga-------ctgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgc |
292 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||| || |||| ||||||||||| | |||||| ||||||||| ||||| | |||| |
|
|
| T |
3116299 |
tggcgcaaccggtaaagttgttgtcatgtgagttgcgactgaaaggtcatgggttcaagtcatggaaacaacctcttgtataaaaat-------gactgc |
3116207 |
T |
 |
| Q |
293 |
gtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
| |||||||||| || |||||||||||||| |||||| |||||||||||||||||| || |||||| ||||||| |
|
|
| T |
3116206 |
gcacaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgccct |
3116131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 308 - 366
Target Start/End: Complemental strand, 10734965 - 10734907
Alignment:
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||| || ||||||| |||||| |
|
|
| T |
10734965 |
tggtgggcccccttcccggaccctgcgtatgcgggagctttagtccaccgggctgccct |
10734907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 210 - 304
Target Start/End: Complemental strand, 2755583 - 2755488
Alignment:
| Q |
210 |
ggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgta-gaaaaacagggtaaggctgcgtacaatacacc |
304 |
Q |
| |
|
|||||||||||||||||||||||| || ||| |||||||||| | ||||| |||||| || ||||| ||| ||||||||||||||||||||| |
|
|
| T |
2755583 |
ggtaaagttgttgtcatgtgactgaaaggtcgtaggttcaagtcttgcaaacatcctcttataccaaaaataggctaaggctgcgtacaatacacc |
2755488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 204 - 263
Target Start/End: Original strand, 8417442 - 8417501
Alignment:
| Q |
204 |
gcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacag |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| ||||| ||| | ||||||| |
|
|
| T |
8417442 |
gcaactggtaaagttgttgtcatgtgactgaaatgtcacgagttcaggtcatggaaacag |
8417501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 308 - 358
Target Start/End: Original strand, 11395836 - 11395886
Alignment:
| Q |
308 |
tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgg |
358 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| || |||||| |
|
|
| T |
11395836 |
tggtgggaccccttcccggatcctgcgtatgcgggagctttagtccaccgg |
11395886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 306 - 364
Target Start/End: Complemental strand, 14975152 - 14975094
Alignment:
| Q |
306 |
aatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
|||||||||||||||| ||| |||| || |||||||||| ||| ||||||||||||||| |
|
|
| T |
14975152 |
aatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcaccgggttgcc |
14975094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 280 - 366
Target Start/End: Original strand, 17432393 - 17432481
Alignment:
| Q |
280 |
agggtaaggctgcgtacaatacaccgaa--tggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||| ||||||||||| || ||||| |||| || ||||| |||| | ||||||||||||| ||||||||||||||||| |
|
|
| T |
17432393 |
agggtaaggctgtgtacaatacactaaaaatggtgagaccttttcccggatcctgtgcatgcgggagctttagtgcaccgggttgccct |
17432481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 274 - 367
Target Start/End: Original strand, 18254559 - 18254652
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccctg |
367 |
Q |
| |
|
||||||||||||| ||||| |||||||| | ||| |||||||||||| | ||| || ||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
18254559 |
aaaaacagggtaaagctgcatacaatacccaaaatagtgggaccccttcacagactctacgtatatgggagttttggtgcaccgggctgccctg |
18254652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 206 - 304
Target Start/End: Complemental strand, 27855601 - 27855501
Alignment:
| Q |
206 |
aactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctc--ttgtagaaaaacagggtaaggctgcgtacaatacac |
303 |
Q |
| |
|
||||||||||||| |||||||||||||| || ||| || ||| |||||| ||||||| || |||| ||||| |||||||||||||||| ||||||| |
|
|
| T |
27855601 |
aactggtaaagtttttgtcatgtgactgaaatgtcgcgagtttaagtcccgaaaacagcttcctgtgtaaaaaaatagggtaaggctgcgtataatacac |
27855502 |
T |
 |
| Q |
304 |
c |
304 |
Q |
| |
|
| |
|
|
| T |
27855501 |
c |
27855501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 315 - 364
Target Start/End: Complemental strand, 30786427 - 30786378
Alignment:
| Q |
315 |
accccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||||| | ||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
30786427 |
accccttcctggaccgtgcgtatgcgggagctttagtgcaccgggttgcc |
30786378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 274 - 306
Target Start/End: Complemental strand, 14341164 - 14341132
Alignment:
| Q |
274 |
aaaaacagggtaaggctgcgtacaatacaccga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
14341164 |
aaaaacagggtaaggctgcgtacaatacaccga |
14341132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 359
Target Start/End: Original strand, 19340843 - 19340954
Alignment:
| Q |
249 |
aagtcctcgaaacagcctcttgtagaaaaa-cagggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagct |
346 |
Q |
| |
|
||||||| ||| ||||||||||| ||||| |||||||||| ||| |||||||||| || || ||||||||||| | |||||| |||||||||| |||| |
|
|
| T |
19340843 |
aagtcctagaaccagcctcttgtgtaaaaaacagggtaaggttgca-acaatacaccaaaatgatgggaccccttcctggacccggcgtatgcggaagct |
19340941 |
T |
 |
| Q |
347 |
ttggtgcaccggg |
359 |
Q |
| |
|
|| ||||| |||| |
|
|
| T |
19340942 |
ttagtgcaacggg |
19340954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 198 - 233
Target Start/End: Complemental strand, 19649338 - 19649303
Alignment:
| Q |
198 |
cttggcgcaactggtaaagttgttgtcatgtgactg |
233 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19649338 |
cttggcgcaactgataaagttgttgtcatgtgactg |
19649303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 188 - 366
Target Start/End: Original strand, 30533 - 30710
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||| ||||||||||||||| | ||||||||||| | |
|
|
| T |
30533 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgt-gtaaaacagggtagg |
30631 |
T |
 |
| Q |
288 |
gctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
30632 |
gctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
30710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 125; Significance: 3e-64; HSPs: 2)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 190 - 366
Target Start/End: Complemental strand, 13202 - 13026
Alignment:
| Q |
190 |
ggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggc |
289 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||| || ||||| |||||||||||| |||||||||||||| ||||||| |||||||| |
|
|
| T |
13202 |
ggggtaaccttggcgcaaccggtaaagttgttgtcatgtgactgaaaggtcaccggttcaagtcctggaaacagcctcttgcgtaaaaacaaggtaaggc |
13103 |
T |
 |
| Q |
290 |
tgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
13102 |
tgcgtacaatacaccgaatggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgccct |
13026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 189 - 231
Target Start/End: Complemental strand, 17549 - 17507
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgac |
231 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
17549 |
aggggtaaccttaacgcaactgctaaagttgttgtcatgtgac |
17507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 108; Significance: 4e-54; HSPs: 4)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 191 - 366
Target Start/End: Complemental strand, 10226 - 10052
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggct |
290 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||||||| ||||| || |
|
|
| T |
10226 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagagtaagact |
10128 |
T |
 |
| Q |
291 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| ||||||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
10127 |
gcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
10052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 191 - 366
Target Start/End: Complemental strand, 20554 - 20380
Alignment:
| Q |
191 |
gggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggct |
290 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||| | ||||||| ||||| || |
|
|
| T |
20554 |
gggtaaccttgacgcaactggtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacagagtaagact |
20456 |
T |
 |
| Q |
291 |
gcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| ||||||||||| ||||| |||||| ||||||||||||||||| |
|
|
| T |
20455 |
gcgtacaatacaccaaatagtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttgccct |
20380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 186 - 253
Target Start/End: Original strand, 8897 - 8964
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtc |
253 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
8897 |
ttgaggggtaaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaagtc |
8964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 186 - 253
Target Start/End: Original strand, 19225 - 19292
Alignment:
| Q |
186 |
ttgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtc |
253 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||||| || ||||| |||||||||| |
|
|
| T |
19225 |
ttgaggggtaaccttggcgcaaccggtgaagttgttgtcatgtgactgaaatgtcacaggttcaagtc |
19292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 107; Significance: 2e-53; HSPs: 5)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 197 - 366
Target Start/End: Original strand, 46794 - 46964
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaac-agggtaaggctgcgta |
295 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| || ||||||||||||||| || |||||| |||||||| ||||| ||||||||| |||||| |
|
|
| T |
46794 |
ccttggcgcaattggtaaagttgttgtcatgtgactagaaggtcacgggttcaagtgctggaaacaacctcttgtgtaaaaaatagggtaaggttgcgta |
46893 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46894 |
caatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccct |
46964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 187 - 366
Target Start/End: Complemental strand, 24949 - 24774
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaa-cagggta |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||| ||||||||||||| ||||| ||||||| |
|
|
| T |
24949 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtc-----aacagcctcttgtgtaaaaaacagggta |
24855 |
T |
 |
| Q |
286 |
aggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||||| ||| |||||||||||||||||||||| ||||| | ||||||||| |
|
|
| T |
24854 |
aggctgcgtacaacacaccaaatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcagccggttgccct |
24774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 247 - 366
Target Start/End: Original strand, 43672 - 43791
Alignment:
| Q |
247 |
tcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgc-cggaccctgcgtatgcgggagc |
345 |
Q |
| |
|
|||||| || |||||||| |||||| | |||||| ||||||||||||||||||||||| |||||||||||||||| | |||||||||| ||||||||||| |
|
|
| T |
43672 |
tcaagttctggaaacagcgtcttgt-gtaaaacaaggtaaggctgcgtacaatacaccaaatggtgggacccctttctcggaccctgcatatgcgggagc |
43770 |
T |
 |
| Q |
346 |
tttggtgcaccgggttgccct |
366 |
Q |
| |
|
| | |||||| | |||||||| |
|
|
| T |
43771 |
tctagtgcactgagttgccct |
43791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 280 - 348
Target Start/End: Complemental strand, 46796 - 46727
Alignment:
| Q |
280 |
agggtaaggctgcgtacaatacaccgaa-tggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
||||||||| ||| ||||||| ||| || |||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
46796 |
agggtaaggatgcatacaatataccaaaatggtgggaccccttcccagaccctgcgtatgcgggagcttt |
46727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 197 - 255
Target Start/End: Complemental strand, 47054 - 46997
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcct |
255 |
Q |
| |
|
||||||||||| | ||||||||||||||| ||||||| || |||||| ||||||||||| |
|
|
| T |
47054 |
ccttggcgcaa-tagtaaagttgttgtcaggtgactgaaaggtcacgagttcaagtcct |
46997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 102; Significance: 2e-50; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 193 - 366
Target Start/End: Original strand, 58936 - 59112
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgta-gaaaaacagggtaaggctg |
291 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||| || |||||||||||||||||| |||||||||||||||| |||||||||||||| ||| |
|
|
| T |
58936 |
gtaaccttggagcaactggtaaacttattgtcatgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgtataaaaaacagggtaagactg |
59035 |
T |
 |
| Q |
292 |
cgtacaatacacc--gaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||||| |||||||||||||||| || ||| ||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
59036 |
cgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgccct |
59112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 96; Significance: 6e-47; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 197 - 363
Target Start/End: Original strand, 10773 - 10940
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgta |
295 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| || |||||||||||||| || ||||| |||||||| |||| |||||||| |||||||| |
|
|
| T |
10773 |
ccttggtgcaactggtaaagttgttgtcatgtgactggaaggtcacgggttcaaggtctgaaaacaacctcttgtgtaaaaaacagggtagggctgcgtc |
10872 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgc |
363 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
10873 |
caatacaccaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcactgggttgc |
10940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 96; Significance: 6e-47; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 96; E-Value: 6e-47
Query Start/End: Original strand, 195 - 366
Target Start/End: Original strand, 11093 - 11262
Alignment:
| Q |
195 |
aaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgt |
294 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||| || |||||||||||||||||| ||||||||||||||| | |||||| |||||||||| | |
|
|
| T |
11093 |
aaccttggcgcaactggtaaagttgttct-atgtgactgaaaggtcacgggttcaagtcctggaaacagcctcttgt-gtaaaacaaagtaaggctgctt |
11190 |
T |
 |
| Q |
295 |
acaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||||| |||||||||||| | ||||||| ||||||||| |
|
|
| T |
11191 |
acaatacaccaaatggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgccct |
11262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 93; Significance: 4e-45; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 196 - 364
Target Start/End: Complemental strand, 1758 - 1591
Alignment:
| Q |
196 |
accttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgta |
295 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||| || |||| ||||||||||||| ||||| |||||||| | |||||||| ||||||||| || |
|
|
| T |
1758 |
accttgacgcaattggtaaagttgttgtcatgtgactgaaaggtcatgggttcaagtcctgaaaacaacctcttgt-gtaaaacaggataaggctgcata |
1660 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgcc |
364 |
Q |
| |
|
||||||||| |||| ||||||||||| |||||||| ||||||||||||||||| ||||||| ||||||| |
|
|
| T |
1659 |
caatacaccaaatgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 86; Significance: 5e-41; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 187 - 317
Target Start/End: Complemental strand, 226588 - 226456
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttg--tagaaaaacagggt |
284 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
226588 |
tgagtggtaaccttggcgcaactggtaaagttgttgtcatgtgactgaaaggtcacggattcaagtcctagaaacagcctcttgtctaaaaaaacagggt |
226489 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggacc |
317 |
Q |
| |
|
|||||||| ||||||||| | |||||||||||| |
|
|
| T |
226488 |
aaggctgcatacaatacatcaaatggtgggacc |
226456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 243 - 366
Target Start/End: Complemental strand, 48758 - 48636
Alignment:
| Q |
243 |
gggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcggg |
342 |
Q |
| |
|
|||||||||| | ||||||||||||||| | |||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
48758 |
gggttcaagtggtggaaacagcctcttgt-gtaaaacagggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcggg |
48660 |
T |
 |
| Q |
343 |
agctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||| | ||||||||||||||||| |
|
|
| T |
48659 |
agctctagtgcaccgggttgccct |
48636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 75; Significance: 2e-34; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 196 - 366
Target Start/End: Complemental strand, 73034 - 72869
Alignment:
| Q |
196 |
accttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaaca-gcctcttgtagaaaaa-cagggtaaggctgcg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||| | ||||||| ||||| || ||||||||||| |
|
|
| T |
73034 |
accttggcgcaactggtaaagttgttgtcatgtgt-------gtcacgggttcaagtcctagaaacaagtctcttgtgtaaaaaacacggtaaggctgcc |
72942 |
T |
 |
| Q |
294 |
tacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||||||| |||||| | ||||||| ||||| |||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
72941 |
tacaatacaccaaatggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgccct |
72869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 188 - 318
Target Start/End: Complemental strand, 35200 - 35067
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttg-ttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtaga--aaaacagggt |
284 |
Q |
| |
|
||||| |||| |||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||| |||||| ||||||| |||||||||| |
|
|
| T |
35200 |
gagggataactttggtgcaactggtaaagtttattgtcatgtgactgtaaggtcacgggttcaagtcctgaaaacagtctcttgtgtgtgaaaacagggt |
35101 |
T |
 |
| Q |
285 |
aaggctgcgtacaatacaccgaatggtgggaccc |
318 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
35100 |
aaggctgcgtacaatacaccaaatggtgggaccc |
35067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 281 - 366
Target Start/End: Complemental strand, 24220 - 24135
Alignment:
| Q |
281 |
gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||||||| |||||||||||| | ||||||||| ||||||| |
|
|
| T |
24220 |
gggtaaggctgcgtacaatacaccaaatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccct |
24135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 61; Significance: 4e-26; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 193 - 331
Target Start/End: Original strand, 4117 - 4258
Alignment:
| Q |
193 |
gtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctg |
291 |
Q |
| |
|
||||||||| ||||||| ||||||||||||| ||||||||| || |||||||||||||||||| |||||| |||||||| |||| ||||| ||||| || |
|
|
| T |
4117 |
gtaaccttg-cgcaactagtaaagttgttgttatgtgactgaaaggtcacgggttcaagtcctggaaacaacctcttgtgtaaaatacaggataaggttg |
4215 |
T |
 |
| Q |
292 |
cgtacaatacacc---gaatggtgggaccccttgccggaccct |
331 |
Q |
| |
|
||||||||||||| | |||||||||||||| ||||||||| |
|
|
| T |
4216 |
cgtacaatacaccaataattggtgggaccccttcccggaccct |
4258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 187 - 262
Target Start/End: Original strand, 83828 - 83903
Alignment:
| Q |
187 |
tgaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaaca |
262 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| || |||||||||||||||| | |||||| |
|
|
| T |
83828 |
tgaggggtaaccttggcgcaactagtaaagttgttgtcatgtgactgaaaggtcacgggttcaagtcttggaaaca |
83903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0954 (Bit Score: 54; Significance: 7e-22; HSPs: 1)
Name: scaffold0954
Description:
Target: scaffold0954; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 250 - 366
Target Start/End: Original strand, 3560 - 3677
Alignment:
| Q |
250 |
agtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagcttt |
348 |
Q |
| |
|
|||||| |||| |||||||||| |||| | | |||||||||||||| ||||||||||||| ||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
3560 |
agtcctggaaagagcctcttgtgtaaaatataaggtaaggctgcgtataatacaccgaatgatgggaccccttcccgaaccctgcgtatgcggcagcttt |
3659 |
T |
 |
| Q |
349 |
ggtgcaccgggttgccct |
366 |
Q |
| |
|
|||||||| ||| |||| |
|
|
| T |
3660 |
agtgcaccgagtttccct |
3677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: scaffold0194
Description:
Target: scaffold0194; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 189 - 265
Target Start/End: Original strand, 24619 - 24695
Alignment:
| Q |
189 |
aggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcc |
265 |
Q |
| |
|
||||||||||||||| ||| || |||||||||||||| |||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
24619 |
aggggtaaccttggcacaattgataaagttgttgtcaagtgactgtaaggtcacgggttcaagtcctggaaacagcc |
24695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0194; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 281 - 366
Target Start/End: Original strand, 24696 - 24781
Alignment:
| Q |
281 |
gggtaaggctgcgtacaatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttggtgcaccgggttgccct |
366 |
Q |
| |
|
||||||| ||||||| |||||||| ||| |||| |||||| || |||||||||||| ||||||||| ||||||| | ||||||| |
|
|
| T |
24696 |
gggtaagactgcgtataatacaccaaatagtggaccccctttccagaccctgcgtatacgggagcttcagtgcacctgattgccct |
24781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 47; Significance: 1e-17; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 192 - 287
Target Start/End: Original strand, 43085 - 43182
Alignment:
| Q |
192 |
ggtaaccttggcgc--aactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacagggtaag |
287 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||| || || |||||| ||||| ||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
43085 |
ggtaaccttggcgcgcaactggtaaagttattgtcatgtgattgaaaggtcacgagttcaggtcctagaaacagcctcttgtgtaaaaacagagtaag |
43182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0116 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: scaffold0116
Description:
Target: scaffold0116; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 188 - 281
Target Start/End: Original strand, 8848 - 8938
Alignment:
| Q |
188 |
gaggggtaaccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaaacag |
281 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||||||||| ||||| ||||||| |||| |||||| | |||||| |||||||| |
|
|
| T |
8848 |
gaggggtaaccttgacgc---tggtaaagttgttgtcatgtgactgtaaggtcacaggttcaattcctggaaacaacttcttgtgtaaaaacag |
8938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0167 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0167
Description:
Target: scaffold0167; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 197 - 349
Target Start/End: Original strand, 23567 - 23715
Alignment:
| Q |
197 |
ccttggcgcaactggtaaagttgttgtcatgtgactgtaacgtcacgggttcaagtcctcgaaacagcctcttgtagaaaa-acagggtaaggctgcgta |
295 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| || | ||||||||||||| | ||||| |||||||| |||| ||||||| |||||||||| |
|
|
| T |
23567 |
ccttggcgcaac-ggtaaagttgt----atgtgactgaaagggtacgggttcaagtcttgcaaacaacctcttgtgtaaaaaacagggtgaggctgcgta |
23661 |
T |
 |
| Q |
296 |
caatacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagctttg |
349 |
Q |
| |
|
|||| | | |||||||||||||||| || |||| || ||||| |||||||||| |
|
|
| T |
23662 |
caatgtagcaaatggtgggaccccttcccagaccttgagtatgtgggagctttg |
23715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 298 - 346
Target Start/End: Complemental strand, 58699 - 58651
Alignment:
| Q |
298 |
atacaccgaatggtgggaccccttgccggaccctgcgtatgcgggagct |
346 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||| ||||||||||||| |
|
|
| T |
58699 |
atacaccgaatggtgagaccccttctcggaccctgtgtatgcgggagct |
58651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University