View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1477_low_24 (Length: 240)
Name: NF1477_low_24
Description: NF1477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1477_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 9069154 - 9069354
Alignment:
| Q |
17 |
attcttcagctcaagacaactcataaatattatccattttgaatagttgtcgaatcttgttattattttattgcaatagatcttacatcaagttttttag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9069154 |
attcttcagctcaagacaactcataaatattatccattttgagtagttgtcgaatcttgttattattttattgcaatagatcttacatcaagttttttag |
9069253 |
T |
|
| Q |
117 |
ggtaatatggttgctcataaacttacaaagatgatcatatataatgttagttttcattttattttgacatactaagttatattgatcatttgatttttac |
216 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9069254 |
ggtaatatggttgctcataaacttacgaagatgattatatataatgttagttttcattttattttgacatactaagctatattgatcatttgatttttac |
9069353 |
T |
|
| Q |
217 |
t |
217 |
Q |
| |
|
| |
|
|
| T |
9069354 |
t |
9069354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 119 - 222
Target Start/End: Original strand, 28695185 - 28695289
Alignment:
| Q |
119 |
taatatggttgctcataaacttacaaagatgatcatatataatgttagttttcat-tttattttgacatactaagttatattgatcatttgatttttact |
217 |
Q |
| |
|
|||||||||||||||| ||||| ||||| || |||||||||||| |||| |||| ||||| ||||||||| || || ||||| ||||||||||| | |
|
|
| T |
28695185 |
taatatggttgctcatgaacttgcaaaggcgaccatatataatgtcagttctcatctttatattgacatacctgattgtagtgatcctttgatttttaat |
28695284 |
T |
|
| Q |
218 |
gaaat |
222 |
Q |
| |
|
||||| |
|
|
| T |
28695285 |
gaaat |
28695289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University