View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1477_low_26 (Length: 237)
Name: NF1477_low_26
Description: NF1477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1477_low_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 14 - 237
Target Start/End: Complemental strand, 43344012 - 43343789
Alignment:
| Q |
14 |
caaatcttaccattaggaagcacagcggaagttgaatgatacattcttgcaatttgagtaggcatcatcgccttaaacctcaaacccttaggcttatctg |
113 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43344012 |
caaatcttaccattaggaagcacagccgaagttgaatgatacattcttgcaatttgagtaggcatcatcgccttaaacctcaaacccttaggcttatctg |
43343913 |
T |
 |
| Q |
114 |
gattatacaacacaggtgtgtaatttggctggtcagcatcccaccatgcagatgtaccgtattgtgcaccattgatgaacaatagttctccatttgggag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43343912 |
gattatacaacacaggtgtgtaatttggctggtcagcatcccaccatgcagatgtaccgtattgtgcaccattgatgaacaatagttctccatttgggag |
43343813 |
T |
 |
| Q |
214 |
gataagagcatctcctatgcttct |
237 |
Q |
| |
|
||||||||||||||| ||| |||| |
|
|
| T |
43343812 |
gataagagcatctcccatggttct |
43343789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 146 - 216
Target Start/End: Complemental strand, 33440709 - 33440639
Alignment:
| Q |
146 |
tcagcatcccaccatgcagatgtaccgtattgtgcaccattgatgaacaatagttctccatttgggaggat |
216 |
Q |
| |
|
||||||||||||||| ||| ||| || ||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
33440709 |
tcagcatcccaccatccagctgttcccctttgtgcaccattgatgaacaaaagttgtccatttgggaggat |
33440639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 14 - 62
Target Start/End: Complemental strand, 33440841 - 33440793
Alignment:
| Q |
14 |
caaatcttaccattaggaagcacagcggaagttgaatgatacattcttg |
62 |
Q |
| |
|
||||| || ||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
33440841 |
caaatttttccattaggaagcaatgctgaagttgaatgatacattcttg |
33440793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University