View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1477_low_27 (Length: 236)
Name: NF1477_low_27
Description: NF1477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1477_low_27 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 9 - 236
Target Start/End: Complemental strand, 29122296 - 29122069
Alignment:
| Q |
9 |
atcatcacaatgaaacaaagaagaaaagaatgataccaatagttccctcttagaaattctcatactcattggccattgcaaatgttctttctcccactct |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29122296 |
atcaccacaatgaaacaaagaagaaaagaatgataccaatagttccctcttagaaattttcatactcattggccattgcaaatgttctttctcccactct |
29122197 |
T |
 |
| Q |
109 |
tgcacctttgcatgggtcccaattcatacataatgtacaaagtataaatagccatggatataaattgagacatatctccttgtagaaacaataaatatat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29122196 |
tgcacctttgcatgggtcccaattcatacataatgtacaaagtataaatagccatgcatataaattgagacatatctccttgtagaaacaacaaatatat |
29122097 |
T |
 |
| Q |
209 |
acaatatcttcaatttaattcatggctt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
29122096 |
acaatatcttcaatttaattcatggctt |
29122069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University