View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1477_low_31 (Length: 228)
Name: NF1477_low_31
Description: NF1477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1477_low_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 42924846 - 42924660
Alignment:
| Q |
18 |
atgaaatagggtatggtggtaaatgtgcaagtcacgaggcagaatccagatgtttacaaatatgagaaacagcgtggttctggcaattgcaattgcatca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
42924846 |
atgaaatagggtatggtggtaaatgtgcaagtcacgaggcagaatccagatgtttacaaatatgagaaacagcgtggttctggcaatcgcaattgcatca |
42924747 |
T |
|
| Q |
118 |
gtagtgttagagtgctgctataaatcatgtttgattattcatacttccgggggaaataattgtttaaatttacctttagtaataagatatg |
208 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42924746 |
gtagtgtt----tgctgctataaatcatgtttgattattcatacttccgggggaaataattgtttaaatttacctttagtaataagatatg |
42924660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University