View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1477_low_9 (Length: 342)
Name: NF1477_low_9
Description: NF1477
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1477_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 16 - 337
Target Start/End: Original strand, 30888423 - 30888744
Alignment:
| Q |
16 |
atttcaacaaccatatcccatgtataaatcatttatacattttgtctaattattattataataattgacatccatcaaccaatgataagaaatcgtacaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888423 |
atttcaacaaccatatcccatgtataaatcatttatacattttgtctaattattattataataattgacatccatcaaccaatgataagaaatcgtacaa |
30888522 |
T |
|
| Q |
116 |
ccatgccgacatcaaatgaataaaacatcacctcttctttgccacaagatctcatgtccaatgattgtgaataaacatccaacggttctagcttctcacg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888523 |
ccatgccgacatcaaatgaataaaacatcacctcttctttgccacaagatttcatgtccaatgattgtgaataaacatccaacggttctagcttctcacg |
30888622 |
T |
|
| Q |
216 |
aattcttcgttcataacttcataaatataatcttgattgtgatgagnnnnnnngactcaaagtgatgagttagttacgcatcgttttaccatggacccga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30888623 |
aattcttcgttcataacttcataaatataatcttgattgtgatgagtttttttgactcaaagtgatgagttagttacgcatcgttttaccatggacccga |
30888722 |
T |
|
| Q |
316 |
ccacatcaattatttctctgct |
337 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30888723 |
ccacatcaattatttctctgct |
30888744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University