View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_high_13 (Length: 356)
Name: NF14780_high_13
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 19 - 337
Target Start/End: Complemental strand, 43286509 - 43286189
Alignment:
| Q |
19 |
taggggctttgaaacgaagtgggatggagaagaataccggctcttctgcggagatgaaggtcgggtttgggaagccaatcttctccgtagttttgcggca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43286509 |
taggggctttgaaacgaagtgggatggagaagaataccggctcttctgcggagatgaaggtcgggtttgggaagccaatcttctccgtagttttgcggca |
43286410 |
T |
 |
| Q |
119 |
aatcttcaccgacggtgaattgagttaaggaagtggtaaccaaagacgaagaagcagcacgagggaaggaaagtggtgaagaattgagtttgaaactggg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43286409 |
aatcttcaccgacggtgaattgagttaaggaagtggtaaccaaagacgaagaagcagcacgagggaaggaaagtggtgaagaattgagtttgaaactagg |
43286310 |
T |
 |
| Q |
219 |
aatgggtgatgatgtaaaggtacaccgtcggagttgtgggaaagacagtgttgtgatgctgagactcagagtcaaagacatttctttctcgctctattga |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43286309 |
aatgggtgatgatgtaaaggtacaccgtcggagttgtgggaaagacagtgttgtgatgctgagactcagagtcaaagacatttctttctcgctctattga |
43286210 |
T |
 |
| Q |
319 |
tt--gtatttgcagttccaaa |
337 |
Q |
| |
|
|| ||||||||||||||||| |
|
|
| T |
43286209 |
ttcagtatttgcagttccaaa |
43286189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University