View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_high_28 (Length: 236)
Name: NF14780_high_28
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 16 - 106
Target Start/End: Original strand, 33265882 - 33265972
Alignment:
| Q |
16 |
attatagcctctctgatgatgacttggtcaaaatcttcttgggatcaatttggttaagaacctttcttattatttggctcgtctcaccatt |
106 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33265882 |
attataacctctctgatgttgacttggtcaaaatcttcttgggatcaatttggttaagaacctttcttattatttggctcgtctcaccatt |
33265972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 104 - 191
Target Start/End: Original strand, 33266013 - 33266099
Alignment:
| Q |
104 |
atttcatggcattagtctggcttaatgtaagctgagccgctgtgaaacgaaaaatgaatcttatctaactatgaaaaattgtatagga |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33266013 |
atttcatggcattagtctggcttaatgtaagctgagccgctgtgaaacgaaaaatgaatcttatctaactatg-aaaattgtatagga |
33266099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 192 - 227
Target Start/End: Original strand, 33266116 - 33266151
Alignment:
| Q |
192 |
gtgccttacggcaaaagaaacaaatttcagtattat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |
|
|
| T |
33266116 |
gtgccttacggcaaaagaaacaaatttcattattat |
33266151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University