View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_high_3 (Length: 490)
Name: NF14780_high_3
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_high_3 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 32 - 242
Target Start/End: Complemental strand, 34580727 - 34580517
Alignment:
| Q |
32 |
aacccgcgtacgagaacgaaacaaaattgcagaaaaagaagtgttgcgtaggttgacaagctttggaccagaactttgagtgccgggataggactctacc |
131 |
Q |
| |
|
||||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34580727 |
aacccacgtacgagaacaaaacaaaattgcaaaaaaagaagtgttgcgtaggttgacaagctttggaccagaactttgagtgccgggataggactcgacc |
34580628 |
T |
|
| Q |
132 |
gctaacacggtagcaaatccacaaaccccaaccatttactatctcaaaaaacagtaaatttatggtgccatttctggccatacagtgtctaacattaata |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34580627 |
actaacacggtagcaaatccacaaaccccaaccatttactatctcaaaaaacagtaaatttatggtgccatttctggccatacagtgtctaacattaata |
34580528 |
T |
|
| Q |
232 |
acttaatgcag |
242 |
Q |
| |
|
||||||||||| |
|
|
| T |
34580527 |
acttaatgcag |
34580517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 312 - 472
Target Start/End: Complemental strand, 34580446 - 34580288
Alignment:
| Q |
312 |
gtaatttagccaaatttatacaaccattatactacgttattgagatggcgtctcaacaatatatatatcaaatccatttggttagaaatcattctgcatg |
411 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
34580446 |
gtaatttagcaaaatttatacaaccattatactacgttattgagatggcgtctcaacaatatatat--caaatccatttggttagaaatcattctgcata |
34580349 |
T |
|
| Q |
412 |
ctcaattcaccaagtaagctagctgcttgtaacagctatatatgtataaaattatacaaac |
472 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34580348 |
ctcagttcaccaagtaagctagctgcttgtaacagctatatatgtataaaattatgcaaac |
34580288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University