View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_high_37 (Length: 206)
Name: NF14780_high_37
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_high_37 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 56 - 206
Target Start/End: Complemental strand, 33816296 - 33816148
Alignment:
| Q |
56 |
aatttagatatacgtgtaaaattgtttaattggatatatgtgtaaaattgttttacatttatagtgtgtatgatatgctcgatatttttaagagtttaat |
155 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| || |||||||||||||||||||||| ||||||||||| |
|
|
| T |
33816296 |
aatttagatatatgtgtaaaattgttttcttggatat--gtgtaaaattgttttacatttattgtatgtatgatatgctcgatattttcaagagtttaat |
33816199 |
T |
|
| Q |
156 |
taatatgttttgtaagatcatctcagatggtgaggtcttcaccatttaaga |
206 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||| ||||||||| |
|
|
| T |
33816198 |
taatatgttttgtaagaccatctcatatggtgaggtcttcatcatttaaga |
33816148 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 33816450 - 33816408
Alignment:
| Q |
1 |
atatgacaagattagaatataggagtagataaatcctaagtag |
43 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33816450 |
atatgacaagattagaacataggagtagataaatcctaagtag |
33816408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 168 - 206
Target Start/End: Complemental strand, 33099782 - 33099744
Alignment:
| Q |
168 |
taagatcatctcagatggtgaggtcttcaccatttaaga |
206 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33099782 |
taagatcatctctaatggtgaggtcttcaccatttaaga |
33099744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University