View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_low_17 (Length: 341)
Name: NF14780_low_17
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 13 - 277
Target Start/End: Original strand, 43186018 - 43186282
Alignment:
| Q |
13 |
acctgtgaagagcacaagcctggcacttgttgcnnnnnnnctctaacctctggaaaacctacatcgcagagcggaaaatggttgctaactcaacatttct |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
43186018 |
acctgtgaagagcacaagcctggcacttgttgcaaaaaacctctaacctctggaaaacctacatcgcagagtggaaaatggttgctaagtcaacatttct |
43186117 |
T |
 |
| Q |
113 |
tcagatgttatgaagctaaaacaaccactaacatcttagcaattggttttttcaattggtaaatccaacttaagccaaaatgaatggtttaaaaataacc |
212 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186118 |
tcagatgttatgaagctgaaacaaccactaacatcttagcaattggttttttcaattggtaaatccaacttaagccaaaatgaatggtttaaaaataacc |
43186217 |
T |
 |
| Q |
213 |
actgttgtcgattgcagatcgcggagaagagtggtttgcttgaaattggctatgctacgagctat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186218 |
actgttgtcgattgcagatcgcggagaagagtggtttgcttgaaattggctatgctacgagctat |
43186282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 279 - 338
Target Start/End: Complemental strand, 43186398 - 43186339
Alignment:
| Q |
279 |
cagctgccttccgccccccatgcataggtccggtttatcccttaagattattttagtgtt |
338 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
43186398 |
cagctgccttccgccccccatgcagaggtccggtgtatcctttaagattattttagtgtt |
43186339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University