View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_low_21 (Length: 291)
Name: NF14780_low_21
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 43187926 - 43188167
Alignment:
| Q |
1 |
tattcttggttcaatgttcagtctttaaaacactgcaattaattgaattcatattgtgacctccactgatatctttcaattcatgaagaaaaatggaatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
43187926 |
tattcttggttcaatgttcagtctttaaaacactgcaattaattgaattcatattgtgacctccactgatatctttcagttcatgaagaaaaatggaatg |
43188025 |
T |
|
| Q |
101 |
gaatacaatgagacgaaatttgagaggatttgattgtcgaaggtctgtttttctcaacatcatcgttgttacaactagaaagcatttagtgactcttact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43188026 |
gaatacaatgagacgaaatttgagaggatttgattgtcgaaggtctgtttttctcaacatcatcgttgttacaactagaaagcatttagtgactcttatt |
43188125 |
T |
|
| Q |
201 |
gagctacttgtcttatatctcggtgctcaactgctggatttt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43188126 |
gagctacttgtcttatatctcggtgctcaactgctggatttt |
43188167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 22710090 - 22710133
Alignment:
| Q |
16 |
gttcagtctttaaaacactgcaattaattgaattcatattgtga |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22710090 |
gttcagtctttaaaacactgcaattaattgaagtcatattgtga |
22710133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University