View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_low_23 (Length: 281)
Name: NF14780_low_23
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 9e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 109 - 268
Target Start/End: Complemental strand, 11174037 - 11173878
Alignment:
| Q |
109 |
aaatgttcatgaaattaaaccgtagaagaggaatttagtggtggtggagttgtgtctaaaggtggttttcactggttgaaaatatatcaaacacataaaa |
208 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11174037 |
aaatgttcatgaaattaaattgtagaagaggaatttagtggtggtggagttgtgtctaaaggtggttttcactggttgaaaatatatcaaacacataaaa |
11173938 |
T |
|
| Q |
209 |
ataacccatttcaaaggtagttcctttctcgttccaaaaataaaaggtagtttgctttca |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
11173937 |
ataacccatttcaaaggtagttcctttctcattccaaaaacaaaaggtagtttgctttca |
11173878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University