View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_low_26 (Length: 258)
Name: NF14780_low_26
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 39082977 - 39083224
Alignment:
| Q |
1 |
tttatcagatcacgaagcatttttactcatcaaagggtgagtgggagaactggaattggagatctgaaggagatctaatgttgaatggtgcctacttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39082977 |
tttatcagatcacgaagcatttttactcatcaaagggtgagtgggagaactggaattggagatctgaaggagatctaatgttgaatggtgcctacttcac |
39083076 |
T |
 |
| Q |
101 |
accgtctggagcgggagcatcttcttcgacatatgccaaagcctcaagcatgtcagcacgaccacctatgcttgtggcttcaatgacagcaggagctgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39083077 |
accgtctggagcgggagcatcttcttcgacatatgccaaagcctcaagcatgtcagcacgaccacctatgcttgtggcttcaatgacagcaggagctgga |
39083176 |
T |
 |
| Q |
201 |
gtgcttagatgcaaaaagggttaccaatgctactactagactggtatc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39083177 |
gtgcttagatgcaaaaagggttaccaatgctactactagattggtatc |
39083224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 31727809 - 31728047
Alignment:
| Q |
1 |
tttatcagatcacgaagcatttttactcatcaaagggtgagtgggagaactggaattggagatctgaaggagatctaatgttgaatggtgcctacttcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
31727809 |
tttatcagatcacgaagcatttttactcatcaaaaggtgagtgggagaactggact-ggagatctgaaggagatctaatattgaatggtgcctatttcac |
31727907 |
T |
 |
| Q |
101 |
accgtctggagcgggagcatcttcttcgacatatgccaaagcctcaagcatgtcagcacgaccacctatgcttgtggcttcaatgacagcaggagctgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || || |||||| |
|
|
| T |
31727908 |
accgtctggagcgggagcatcttcttcgacatatgccaaagcctcaagtatgtcagcacgaccacctatgcttgtggcttcaatgactgctggtgctgga |
31728007 |
T |
 |
| Q |
201 |
gtgcttagatgcaaaaagggttaccaatgctactactaga |
240 |
Q |
| |
|
|| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31728008 |
gttcttagatgcaaaaagggttaccaatgctacgactaga |
31728047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University