View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_low_28 (Length: 248)
Name: NF14780_low_28
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_low_28 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 103 - 178
Target Start/End: Complemental strand, 38706664 - 38706589
Alignment:
| Q |
103 |
tgctgttttattgttgtatttatgttgttccctctaggtcttggtaccttggagatctttgtttttgtatccctgt |
178 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38706664 |
tgctgttttgttgttgtatttatgctgttccctctaggtcttggtaccatggagatctttgtttttgtatccctgt |
38706589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 225
Target Start/End: Complemental strand, 38706554 - 38706517
Alignment:
| Q |
188 |
tctaattttattttggcagttaaaaagttaaaataaaa |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38706554 |
tctaattttattttggcagttaaaaagttaaaataaaa |
38706517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University