View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_low_29 (Length: 237)
Name: NF14780_low_29
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 671218 - 671421
Alignment:
| Q |
1 |
tatgtgaaaagttgagaagcgagaatcatttcaaaccacagctttggtataaaaatcataattattataggatcttagtgattcttttaattataattca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
671218 |
tatgtgaaaagttgagaagcgagaatcatttcaaaccacagctttggtataaaaatcataattattataggatcttagtgattcttttaattataattca |
671317 |
T |
 |
| Q |
101 |
tattc--atatatgctaatctgttgaattcgtgtgcttctgtatcataaaaagggacagcatgcatggttacattcaccatcaatcaatggtaaaacaaa |
198 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
671318 |
tattcatatatatgctaatttgttgaattcgtgtgcttctgtatcataaaaagggacagcatgcatggtaacattcaccatcaatcaatggtaaaacaaa |
671417 |
T |
 |
| Q |
199 |
aggg |
202 |
Q |
| |
|
|||| |
|
|
| T |
671418 |
aggg |
671421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University