View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_low_39 (Length: 211)
Name: NF14780_low_39
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 12 - 198
Target Start/End: Original strand, 42089308 - 42089494
Alignment:
| Q |
12 |
attattctataatgcgtgggtgagtgatctcaaagaaacataactgagacggcacggcacacattgggaagatttcagttggagcataataattaaatat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42089308 |
attattctataatgcgtgggtgagtgatctcaaagaaacataactgggacggcacggcacacattgggaagatttcagttggagcataataattaaatat |
42089407 |
T |
 |
| Q |
112 |
atatgatgagtttggaaaattagctttgaagattaataaaatacattttgtgcattcacgtggtcataataaacctgttggttatga |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42089408 |
atatgatgagtttggaaaattagctttgaagattaataaaatacattttgtgcattcacgtgatcataataaacctgttggttatga |
42089494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University