View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14780_low_42 (Length: 204)
Name: NF14780_low_42
Description: NF14780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14780_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 185
Target Start/End: Complemental strand, 9445266 - 9445100
Alignment:
| Q |
19 |
aatgtcaattccaaaaacctgtgaaggaaaggacgaggggttcgattatcagtgacagaaacagaaatatgaaatccatttgtgtctattggatttatca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9445266 |
aatgtcaattccaaaaacctgtgaaggaaaggacgaggggttcgattatcagtgacagaaacagaaatatgaaatccatttgtgtctattggatttatca |
9445167 |
T |
|
| Q |
119 |
agtttagtccaatagtaagctacctcgctaacacggctttgcaaagccaaggccaagactttgcgtc |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9445166 |
agtttagtccaatagtaagctacctcgctaacacggctttgcaaagccaaggccaagactttgcgtc |
9445100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University