View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14782_low_17 (Length: 233)
Name: NF14782_low_17
Description: NF14782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14782_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 17 - 219
Target Start/End: Complemental strand, 1423102 - 1422900
Alignment:
| Q |
17 |
aaaaaggatataaacaatgactatatcaaatcttgttttgatttgttcatcacaagattaatttaaaaatatatttaacacaagtagtgactacgtcaaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1423102 |
aaaaaggatataaacaatgactatatcaaatcttgttttgatttgttcatcacaagattaatttaaaaatatatttaacacaagtagtgactacgtcaaa |
1423003 |
T |
 |
| Q |
117 |
tctacttataattatgtcattatacaaatttcatactttatgataaatcctcttttagttttgtaattacaaatattttcaacttaagaattacgtacct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1423002 |
tctacttataattatgtcattatacaaatttcatactttatgataaatcctattttagttttgtaattacaaatattttcaacttaagaattacgtacct |
1422903 |
T |
 |
| Q |
217 |
ttg |
219 |
Q |
| |
|
||| |
|
|
| T |
1422902 |
ttg |
1422900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University