View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14783_low_14 (Length: 265)
Name: NF14783_low_14
Description: NF14783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14783_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 14537379 - 14537609
Alignment:
| Q |
16 |
atccagggctagaaacaatatgggttcttgaacaaaaactctatcatatagatgtgtgttgaacaatctgggtacttgaaaaaagaattgcagtgagtta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14537379 |
atccagggctagaaacaatatgggttcttgaacaaaaactctatcacatagatgtgtgttgaacaatctgggtacttgaaaaaagaattgcagtgagtta |
14537478 |
T |
 |
| Q |
116 |
tggttttatgaacaacaacccaaaatggcgacgatgggtggcgaggcatagacaattggaaggagaaatctattgggcgccgctaataatgcacaggaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
14537479 |
tggttttatgaacaacaacccaaaatggcgacgatgggtggcgaggcatagacaattggaaggagaaatctgtagggcgccgctaataatgcacatgaaa |
14537578 |
T |
 |
| Q |
216 |
agagatgggtttgaaattttgagaaagaaga |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14537579 |
agagatgggtttgaaattttgagaaagaaga |
14537609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University