View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14783_low_14 (Length: 265)

Name: NF14783_low_14
Description: NF14783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14783_low_14
NF14783_low_14
[»] chr6 (1 HSPs)
chr6 (16-246)||(14537379-14537609)


Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 246
Target Start/End: Original strand, 14537379 - 14537609
Alignment:
16 atccagggctagaaacaatatgggttcttgaacaaaaactctatcatatagatgtgtgttgaacaatctgggtacttgaaaaaagaattgcagtgagtta 115  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
14537379 atccagggctagaaacaatatgggttcttgaacaaaaactctatcacatagatgtgtgttgaacaatctgggtacttgaaaaaagaattgcagtgagtta 14537478  T
116 tggttttatgaacaacaacccaaaatggcgacgatgggtggcgaggcatagacaattggaaggagaaatctattgggcgccgctaataatgcacaggaaa 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| ||||    
14537479 tggttttatgaacaacaacccaaaatggcgacgatgggtggcgaggcatagacaattggaaggagaaatctgtagggcgccgctaataatgcacatgaaa 14537578  T
216 agagatgggtttgaaattttgagaaagaaga 246  Q
    |||||||||||||||||||||||||||||||    
14537579 agagatgggtttgaaattttgagaaagaaga 14537609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University