View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14783_low_17 (Length: 236)
Name: NF14783_low_17
Description: NF14783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14783_low_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 16502046 - 16501827
Alignment:
| Q |
1 |
gtttttgtaaaatgcacattggggtaattgctggcttgttgttttgtcttggaaatgcgtatggatttcaggaccatcaagtttgcgtgtgtcatgttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16502046 |
gtttttgtaaaatgcacattggggtaattgctggcttgttgttttgtcttggaaatgcgtatggatttcaggaccatcaagtttgcgtgtgtcatgttaa |
16501947 |
T |
 |
| Q |
101 |
atactgattatgnnnnnnncgttgtgcatgacttgttaagcctagaagttagtgtattgtgctgtgtttgattctggacaccaatttctcccattctagt |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16501946 |
atactgattatgaaaaaaacgttgtgcatgacttgttaagcctagaagttagtgtattgtgctgtgtttgattctggacaccaatttctcccattctagt |
16501847 |
T |
 |
| Q |
201 |
taagggtaaagtattgattt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
16501846 |
taagggtaaagtattgattt |
16501827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 13096584 - 13096803
Alignment:
| Q |
1 |
gtttttgtaaaatgcacattggggtaattgctggcttgttgttttgtcttggaaatgcgtatggatttcaggaccatcaagtttgcgtgtgtcatgttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13096584 |
gtttttgtaaaatgcacattggggtaattgctggcttgttgttttgtcttggaaatgcgtatggatttcaggaccatcaagtttgcgtgtgtcatgttaa |
13096683 |
T |
 |
| Q |
101 |
atactgattatgnnnnnnncgttgtgcatgacttgttaagcctagaagttagtgtattgtgctgtgtttgattctggacaccaatttctcccattctagt |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13096684 |
atactgattatgaaaaaaacgttgtgcatgacttgttaagcctagaagttagtgtgttgtgctgtgtttgattctggacaccaatttctcccattctagt |
13096783 |
T |
 |
| Q |
201 |
taagggtaaagtattgattt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
13096784 |
taagggtaaagtattgattt |
13096803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University