View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14783_low_19 (Length: 226)
Name: NF14783_low_19
Description: NF14783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14783_low_19 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 3 - 226
Target Start/End: Original strand, 12919707 - 12919935
Alignment:
| Q |
3 |
tcacgcctttttgttccagtcgccctctggttggcagaatgtcgcgggccagtcgccacaaaaagtttctagtaca-----gtttggagcatgcattttc |
97 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
12919707 |
tcacgcctttttgttccagtcggcctctggttggcagaatgttgcgggccagtcgccacaaaaagtttctagtcctagcctgtttggagcatgcattttc |
12919806 |
T |
|
| Q |
98 |
cagactgctctccaaagcctttggtcaatcatagaagaagcttcagggttctctctactgttgtcatcttgtatcgaatggtaagccgaacgcacagagt |
197 |
Q |
| |
|
||| ||||||||||||||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12919807 |
cagtctgctctccaaagcctttggtcactcaaagatgaagcttcagggttctctctactgttgtcatcttgtatcgaatggtaagccgaacgcacagagt |
12919906 |
T |
|
| Q |
198 |
aattaccatttctttcccaatgcaaaatc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12919907 |
aattaccatttctttcccaatgcaaaatc |
12919935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University