View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14783_low_4 (Length: 457)
Name: NF14783_low_4
Description: NF14783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14783_low_4 |
 |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 8)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 176 - 440
Target Start/End: Complemental strand, 37427093 - 37426840
Alignment:
| Q |
176 |
ctagtttttattaagggaagaagaacacgtaggagagccataagcaacttagaacagaaccgaacaaaatctcttcatccaccacccataatcaacaact |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37427093 |
ctagtttttattaagggaagaagaacacgtaagagagccataagcaacttagaacagaaccgaacaaaatctcttcatccaccacccataatcaacaact |
37426994 |
T |
 |
| Q |
276 |
cccttcgccaccctcctctgccaccgacctcctccacaccgtcgactatcagctgttcacctctctcttctcaatctcttgttacacagtggaattgaat |
375 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37426993 |
cccttcgccgccctcctctgccaccgacctcctccacaccgtcgactatcagttgttcacctctctcttctcaatctcttgttacacagtggaattgaat |
37426894 |
T |
 |
| Q |
376 |
tgggattaattaaggattaatccaggttgatgaattgatttacaaccaccaatatactatgagac |
440 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37426893 |
tgggat-----------taatccaggttgatgaattgatttacaaccaccaatatactatgagac |
37426840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 77 - 151
Target Start/End: Complemental strand, 37427181 - 37427107
Alignment:
| Q |
77 |
cttcaatgcctttaaggcgccaaagtcacctgcctttgccccaatcaaatgttgccaagtgtccctgctttgttt |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37427181 |
cttcaatgcctttaaggcgccaaagtcacctgcctttgcaccaatcaaatgttgccaagtgtcactgctttgttt |
37427107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 35 - 78
Target Start/End: Complemental strand, 27678600 - 27678557
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgct |
78 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
27678600 |
accggttcaaccggccggtccggtccggttttcaaaactatgct |
27678557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 35 - 78
Target Start/End: Original strand, 3656586 - 3656629
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgct |
78 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
3656586 |
accggttcaaccggccggtccggtccagttttcaaaactatgct |
3656629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 13486496 - 13486455
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
13486496 |
accggttcaaccggccggtccggtccgcttttcaaaactatg |
13486455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 35 - 84
Target Start/End: Complemental strand, 40484730 - 40484681
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgcttcaatg |
84 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| |||||||||||| |||| |
|
|
| T |
40484730 |
accggttcgaccggccggtccggtccggtttttaaaactatgcttaaatg |
40484681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 39 - 76
Target Start/End: Complemental strand, 5969333 - 5969296
Alignment:
| Q |
39 |
gttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
5969333 |
gttcaaccggccggtccggtccggttttcaatactatg |
5969296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 35 - 75
Target Start/End: Original strand, 14910932 - 14910972
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactat |
75 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
14910932 |
accggttcgaccggccggtccgatccggttttcaaaactat |
14910972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 35 - 80
Target Start/End: Original strand, 11466198 - 11466243
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgcttc |
80 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11466198 |
accggttcaaccggccggtccggtccggttttcaaaactatgcttc |
11466243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 22350512 - 22350471
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
22350512 |
accggttcgaccggccggtccggtccggttttcaaaactatg |
22350471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 21528140 - 21528099
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
21528140 |
accggttgaaccggccggtccggtccgggtttcaaaactatg |
21528099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 35 - 79
Target Start/End: Complemental strand, 37314268 - 37314224
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgctt |
79 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
37314268 |
accggttcaaccggccggtccggtccggttttcaaaactatgctt |
37314224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 38 - 79
Target Start/End: Original strand, 18541523 - 18541564
Alignment:
| Q |
38 |
ggttcaaccggccgggccggtccggttttcaaaactatgctt |
79 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
18541523 |
ggttcgaccggccggtccggtccggttttcaaaactatgctt |
18541564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Original strand, 7502187 - 7502228
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
||||||| |||||||||| ||||||||| ||||||||||||| |
|
|
| T |
7502187 |
accggttgaaccggccggtccggtccgggtttcaaaactatg |
7502228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 29523163 - 29523122
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
29523163 |
accggttcgaccagccggtccggtccggttttcaaaactatg |
29523122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000003; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 23241360 - 23241319
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23241360 |
accggttcaaccggccggtccggtccggttttcaaaactatg |
23241319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 35 - 78
Target Start/End: Complemental strand, 2848535 - 2848492
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgct |
78 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
2848535 |
accggttcgaccggccggtccggtccggtttttaaaactatgct |
2848492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 30464538 - 30464497
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||||||||||||| |||||| | |||||||||||||| |
|
|
| T |
30464538 |
accggttcaaccggccggtccggtctgattttcaaaactatg |
30464497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Original strand, 33635835 - 33635876
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
33635835 |
accggttcgaccggccgatccggtccggttttcaaaactatg |
33635876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 77
Target Start/End: Original strand, 13448 - 13490
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgc |
77 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13448 |
accggttcaaccggccggttcggtccggttttcaaaactatgc |
13490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000007; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 35 - 76
Target Start/End: Original strand, 29984198 - 29984239
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29984198 |
accgattcaaccggccggtccggtccggttttcaaaactatg |
29984239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 35 - 79
Target Start/End: Original strand, 1583220 - 1583264
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgctt |
79 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| |||||||||||| |
|
|
| T |
1583220 |
accggttcaaccggccggtccggtccgatttttaaaactatgctt |
1583264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 35 - 78
Target Start/End: Complemental strand, 14801323 - 14801280
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgct |
78 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
14801323 |
accggttcaaccggccgatccggtccgattttcaaaactatgct |
14801280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 35 - 78
Target Start/End: Complemental strand, 15248315 - 15248272
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgct |
78 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
15248315 |
accggttcaaccggccgatccggtccgattttcaaaactatgct |
15248272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 11733520 - 11733479
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
11733520 |
accggttcgaccgaccggtccggtccggttttcaaaactatg |
11733479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Original strand, 20624059 - 20624100
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
20624059 |
accggttcaaccggccggtccgatccggttttaaaaactatg |
20624100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 36098865 - 36098824
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| ||||||||| |
|
|
| T |
36098865 |
accggttcgaccggccggtccggtccggtttttaaaactatg |
36098824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000003; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 35 - 79
Target Start/End: Original strand, 40144672 - 40144716
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgctt |
79 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||||||||||| |
|
|
| T |
40144672 |
accggttcaaccgaccggtccggcccggttttcaaaactatgctt |
40144716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 35 - 78
Target Start/End: Complemental strand, 33898193 - 33898150
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgct |
78 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33898193 |
accggtccaaccggccggttcggtccggttttcaaaactatgct |
33898150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 8760249 - 8760208
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
8760249 |
accggttcgaccggccgatccggtccggttttcaaaactatg |
8760208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Original strand, 22638808 - 22638849
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||||||||||||| ||| |||| |||||||||||||| |
|
|
| T |
22638808 |
accggttcaaccggccggtccgatccgattttcaaaactatg |
22638849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 33224150 - 33224109
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||| |
|
|
| T |
33224150 |
accggttcaaccggccggtccgatccggttttaaaaactatg |
33224109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 35 - 77
Target Start/End: Original strand, 28235726 - 28235768
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatgc |
77 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
28235726 |
accggttcgaccggccggtccggtccggtttttaaaactatgc |
28235768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 76
Target Start/End: Original strand, 44258546 - 44258587
Alignment:
| Q |
35 |
accggttcaaccggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||||||||||||| |
|
|
| T |
44258546 |
accggttcaaccggacggtccggtccgattttcaaaactatg |
44258587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 35 - 79
Target Start/End: Complemental strand, 48302529 - 48302484
Alignment:
| Q |
35 |
accggttcaa-ccggccgggccggtccggttttcaaaactatgctt |
79 |
Q |
| |
|
|||||||||| ||| |||| |||||||||||||||||||||||||| |
|
|
| T |
48302529 |
accggttcaaaccgtccggtccggtccggttttcaaaactatgctt |
48302484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 44 - 76
Target Start/End: Original strand, 9294563 - 9294595
Alignment:
| Q |
44 |
accggccgggccggtccggttttcaaaactatg |
76 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
9294563 |
accggccggtccggtccggttttcaaaactatg |
9294595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University