View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14783_low_6 (Length: 380)
Name: NF14783_low_6
Description: NF14783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14783_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 17 - 372
Target Start/End: Complemental strand, 9198017 - 9197662
Alignment:
| Q |
17 |
catctttggcttgtacacttttgatcacaacttggtctaggcttccgtttcataccaccgatttcggttggggggaaccggttctgtctggaccggtttc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9198017 |
catctttggcttgtacacttttgatcacaacttggtctaggcttccgtttcataccaccgatttcggttggggggaaccggttctgtctggaccggtttc |
9197918 |
T |
|
| Q |
117 |
cttgccggagaaggaagtgattttgttcctttcacatggtcaagagaggagaagcattaatgtgcttcttggtttgcccgctcctgtcatgaagaccttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
9197917 |
cttgccggagaaggaagtgattttgttcctttcacatggtcaagagaggagaagcattaatgtgcttcttggtttgcctgctcctgtcatgaagatcttc |
9197818 |
T |
|
| Q |
217 |
caagatttaatgcagatataggataattctattattatgtttcatatggttgtgttattttttattatatggttctgttatcatttcttgaaagagaagt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9197817 |
caagatttaatgcagatataggataattctattattatgtttcatatggttgtgttattttttattatatggttctgttatcatttcttgaaagagaagt |
9197718 |
T |
|
| Q |
317 |
gagttatgtttatgaatttatttgtagtaagcaataactaaggtcttctttatatt |
372 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9197717 |
gagttatgtttatgaatttatttgtagtaagcaataactaaggtcttctttatatt |
9197662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University