View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14783_low_7 (Length: 364)
Name: NF14783_low_7
Description: NF14783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14783_low_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 308; Significance: 1e-173; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 15 - 326
Target Start/End: Complemental strand, 2125105 - 2124794
Alignment:
| Q |
15 |
caaaggaggagaaggaggtgatttcacaataggtggagttggtttcactagagggggagaaggtgccttaacaataggtggtgattgataaggtggtgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2125105 |
caaaggaggagaaggaggtgatttcacaataggtggagttggtttcactagagggggagaaggtgccttaacaataggtggtgattgataaggtggtgat |
2125006 |
T |
 |
| Q |
115 |
tttaccaatggtggagaaggaggtgatttcacaattggtggtgttggtttcactggtggtgattgatatggtggtgttttcaccaatggtggagaaggtg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2125005 |
tttaccaatggtggagaaggaggtgatttcacaataggtggtgttggtttcactggtggtgattgatatggtggtgttttcaccaatggtggagaaggtg |
2124906 |
T |
 |
| Q |
215 |
ctttcacaataggtggtgatttaactaaaggtggtgttggtggtgccttcactggagaaggtggtgttactataggacttggtggagctgtaggatttac |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2124905 |
ctttcacaataggtggtgatttaactaaaggtggtgttggtggtgccttcactggagaaggtggtgttactataggacttggtggagctgtaggatttac |
2124806 |
T |
 |
| Q |
315 |
atagttcacctg |
326 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2124805 |
atagttcacctg |
2124794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 76 - 168
Target Start/End: Complemental strand, 2125149 - 2125057
Alignment:
| Q |
76 |
ggtgccttaacaataggtggtgattgataaggtggtgattttaccaatggtggagaaggaggtgatttcacaattggtggtgttggtttcact |
168 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| ||| ||||| || ||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
2125149 |
ggtgccttcactataggtggtgattgataaggtggtgttttcaccaaaggaggagaaggaggtgatttcacaataggtggagttggtttcact |
2125057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 169 - 230
Target Start/End: Complemental strand, 2125134 - 2125070
Alignment:
| Q |
169 |
ggtggtgattgatatggtggtgttttcaccaatggtggaga---aggtgctttcacaataggtgg |
230 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || ||||| ||||| ||||||||||||||| |
|
|
| T |
2125134 |
ggtggtgattgataaggtggtgttttcaccaaaggaggagaaggaggtgatttcacaataggtgg |
2125070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University