View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14783_low_8 (Length: 348)
Name: NF14783_low_8
Description: NF14783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14783_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 168 - 333
Target Start/End: Complemental strand, 34786106 - 34785941
Alignment:
| Q |
168 |
cattttgttctcagagaaatgacctctggtaatccagaattcggccagaaggtaagtaaagtctgaccaaagtgattgttttagctagaggtcgaacgcg |
267 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
34786106 |
cattttgttctcagagaaatgaactctggtaatccagaattcggccagaaggtaagtaaagtctgaccaaagtgattgttttagctagaggtcaaactcg |
34786007 |
T |
|
| Q |
268 |
actacactcttgatcagttccaccttagcggaatctcattaactgcttaagttcaaccacttaagt |
333 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34786006 |
actacactcttgatcagttcgaccttagcggaatctcattaactacttaagttcaaccacttaagt |
34785941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 20 - 141
Target Start/End: Complemental strand, 34786226 - 34786105
Alignment:
| Q |
20 |
atgcaggttctttaactgcgcttgggttgttaccctcagtgcctactccagacaatatatatgtcttcctgtttaatcccaacagataagaagcaaatcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34786226 |
atgcaggttctttaactgcgcttgggttgttaccctcagtgcctactccagacaatatatatgtcttcctgtttaatcccaacagataagaagcaaatcc |
34786127 |
T |
|
| Q |
120 |
tcctgcaacaaacacaagcaca |
141 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
34786126 |
tcctgcaacaaacacaagcaca |
34786105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University