View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14783_low_9 (Length: 327)
Name: NF14783_low_9
Description: NF14783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14783_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 78; Significance: 3e-36; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 152 - 241
Target Start/End: Complemental strand, 957996 - 957907
Alignment:
| Q |
152 |
tagggaagctcctaaaagttttgaagttggatttttcattcctaatggaaacttttgcagtggcagaagatatttaaaatatctatatat |
241 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
957996 |
tagggaagcttctaaaagttttgaagttggatttttcattcctaatggaaacttttgcagtggcagaagatatttaatatatatatatat |
957907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 230 - 325
Target Start/End: Complemental strand, 957874 - 957779
Alignment:
| Q |
230 |
atatctatatatgctaacagagacaacctagtcctgatttctggtggtacttttgccattgtagaaaatgaaaatctcatggtttgggacagtagt |
325 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
957874 |
atatatatatatgctaacagagacaacgtagtcctgagttctagtggtacttttgccattgtagaaaatgcaaagctcatggttttggacagtagt |
957779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 79
Target Start/End: Complemental strand, 958201 - 958151
Alignment:
| Q |
29 |
tgctatatggcacatcacaacagataaacaagcgagtatcacagtcaatgt |
79 |
Q |
| |
|
||||||||||||| | ||| |||||||||||| |||||||||||||||||| |
|
|
| T |
958201 |
tgctatatggcacttaacatcagataaacaagtgagtatcacagtcaatgt |
958151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University