View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14784_high_102 (Length: 230)
Name: NF14784_high_102
Description: NF14784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14784_high_102 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 76 - 216
Target Start/End: Original strand, 28915618 - 28915758
Alignment:
| Q |
76 |
aacatgatttgaacatacacagtgttagtggtcggttgaggagtgaagatgaaagtggaagagcttccttcattgatatacagagttcatttgaagaatc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28915618 |
aacatgatttgaacatacacagtgttagtggtcggttgaggagtgaagatgaaagtggaagagcttccttcattgatatacagagttcatttgaagaatc |
28915717 |
T |
 |
| Q |
176 |
tgaagagaagatggagaattgagagagaacggagtttactg |
216 |
Q |
| |
|
|| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28915718 |
tgtagagaagatggagaattgagagaggacggagtttactg |
28915758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University